Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VAMP3 cdna clone

VAMP3 cDNA Clone

Gene Names
VAMP3; CEB
Synonyms
VAMP3; VAMP3 cDNA Clone; VAMP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctacaggtccaactgctgccactggcagtaatcgaagacttcagcagacacaaaatcaagtagatgaggtggtggacataatgcgagttaacgtggacaaggttctggaaagagaccagaagctctctgagttagacgaccgtgcagacgcactgcaggcaggcgcttctcaatttgaaacgagcgcagccaagttgaagaggaaatattggtggaagaattgcgagatgtgggcaatcgggattactgttctggttatcttcatcatcatcatcatcgtgtgggttgtctcttcatga
Sequence Length
303
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,309 Da
NCBI Official Full Name
Homo sapiens vesicle-associated membrane protein 3 (cellubrevin), mRNA
NCBI Official Synonym Full Names
vesicle associated membrane protein 3
NCBI Official Symbol
VAMP3
NCBI Official Synonym Symbols
CEB
NCBI Protein Information
vesicle-associated membrane protein 3
UniProt Protein Name
Vesicle-associated membrane protein 3
UniProt Gene Name
VAMP3
UniProt Synonym Gene Names
SYB3; VAMP-3; CEB
UniProt Entry Name
VAMP3_HUMAN

NCBI Description

Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Because of its high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, the protein encoded by this gene was shown to be the human equivalent of the rodent cellubrevin. In platelets the protein resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation. [provided by RefSeq, Jul 2008]

Uniprot Description

VAMP3: SNARE involved in vesicular transport from the late endosomes to the trans-Golgi network. Belongs to the synaptobrevin family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p36.23

Cellular Component: clathrin-coated vesicle; cytosol; intracellular; intracellular membrane-bound organelle; plasma membrane; recycling endosome; SNARE complex; trans-Golgi network membrane; transport vesicle

Molecular Function: protein binding; SNAP receptor activity; SNARE binding

Biological Process: exocytosis; positive regulation of immunoglobulin secretion; positive regulation of receptor recycling; protein complex assembly; retrograde transport, endosome to Golgi; vesicle docking during exocytosis; vesicle fusion; vesicle-mediated transport

Research Articles on VAMP3

Similar Products

Product Notes

The VAMP3 vamp3 (Catalog #AAA1271420) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctacag gtccaactgc tgccactggc agtaatcgaa gacttcagca gacacaaaat caagtagatg aggtggtgga cataatgcga gttaacgtgg acaaggttct ggaaagagac cagaagctct ctgagttaga cgaccgtgca gacgcactgc aggcaggcgc ttctcaattt gaaacgagcg cagccaagtt gaagaggaaa tattggtgga agaattgcga gatgtgggca atcgggatta ctgttctggt tatcttcatc atcatcatca tcgtgtgggt tgtctcttca tga. It is sometimes possible for the material contained within the vial of "VAMP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.