Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPAN cdna clone

PPAN cDNA Clone

Gene Names
PPAN; SSF; SSF1; SSF2; BXDC3; SSF-1
Synonyms
PPAN; PPAN cDNA Clone; PPAN cdna clone
Ordering
For Research Use Only!
Sequence
atgggacagtcagggaggtcccggcaccagaagcgcgcccgcgcccaggcgcagctccgcaacctcgaggcctatgccgcgaacccgcactcgttcgtgttcacgcgaggctgcacgggtcgcaacatccggcagctcagcctggacgtgcggcgggtcatggagccgctcactgccagccgtctgcaggttcgtaagaagaactcgctgaaggactgcgtggcagtggctgggcccctcggggtcacacactttctgatcctgagcaaaacagagaccaatgtctactttaagctgatgcgcctcccaggaggccccaccttgaccttccaggtcaagaagtactcgctggtgcgtgatgtggtctcctcactgcgccggcaccgcatgcacgagcagcagtttgcccacccacccctcctggtactcaacagctttggcccccatggtatgcatgtgaagctcatggccaccatgttccagaacctgttcccctccatcaacgtgcacaaggtgaacctgaacaccatcaagcgctgcctcctcatcgactacaaccccgactcccaggagctggacttccgccactatagcatcaaagttgttcctgtgggcgcgagtcgcgggatgaagaagctgctccaggagaagttccccaacatgagccgcctgcaggacatcagcgagctgctggccacgggcgcggggctgtcggagagcgaggcagagcctgacggcgaccacaacatcacagagctgcctcaggctgtcgctggccgtggcaacatgcgggcccagcagagtgcagtgcggctcaccgagatcggcccgcggatgacactgcagctcatcaaggtccaggagggcgtcggggagggcaaagtgatgttccacagttttgtgagcaagacggaggaggagctgcaggccatcctggaagccaaggagaagaagctgcggctgaaggcgcagaggcaggcccagcaggcccagaatgtgcagcgcaagcaggagcagcgggaggcccacagaaagaagagcctggagggcatgaagaaggcacgggtcgggggtagtgatgaagaggcctctgggatcccttcaaggacggcgagcctggagttaggtgaggacgatgatgaacaggaagatgatgacatcgagtatttctgccaggcggtgggcgaggcgcccagtgaggacctgttccccgaggccaagcagaaacggcttgccaagtctccagggcggaagcggaagcggtgggaaatggatcgaggcaggggtcgcctttgtgaccagaagtttcccaagaccaaggacaagtcccagggagcccaggccaggcgggggcccagaggggcttcccgggatggtgggcgaggccggggccggggccgcccagggaagagagtggcctga
Sequence Length
1422
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
53,194 Da
NCBI Official Full Name
Homo sapiens peter pan homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
peter pan homolog (Drosophila)
NCBI Official Symbol
PPAN
NCBI Official Synonym Symbols
SSF; SSF1; SSF2; BXDC3; SSF-1
NCBI Protein Information
suppressor of SWI4 1 homolog; suppressor of sterile four 1; homolog of S. cerevisiae SSF1; second-step splicing factor 1; brix domain-containing protein 3
UniProt Protein Name
Suppressor of SWI4 1 homolog
Protein Family
UniProt Gene Name
PPAN
UniProt Synonym Gene Names
BXDC3; SSF1; Ssf-1
UniProt Entry Name
SSF1_HUMAN

NCBI Description

The protein encoded by this gene is an evolutionarily conserved protein similar to yeast SSF1 as well as to the gene product of the Drosophila gene peter pan (ppan). SSF1 is known to be involved in the second step of mRNA splicing. Both SSF1 and ppan are essential for cell growth and proliferation. Exogenous expression of this gene was reported to reduce the anchorage-independent growth of some tumor cells. Read-through transcription of this gene with P2RY11/P2Y(11), an adjacent downstream gene that encodes an ATP receptor, has been found. These read-through transcripts are ubiquitously present and up-regulated during granulocyte differentiation. [provided by RefSeq, Nov 2010]

Uniprot Description

SSF1: May have a role in cell growth. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; RNA-binding

Chromosomal Location of Human Ortholog: 19p13

Cellular Component: nucleolus; nucleus

Biological Process: RNA splicing

Research Articles on PPAN

Similar Products

Product Notes

The PPAN ppan (Catalog #AAA1271408) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacagt cagggaggtc ccggcaccag aagcgcgccc gcgcccaggc gcagctccgc aacctcgagg cctatgccgc gaacccgcac tcgttcgtgt tcacgcgagg ctgcacgggt cgcaacatcc ggcagctcag cctggacgtg cggcgggtca tggagccgct cactgccagc cgtctgcagg ttcgtaagaa gaactcgctg aaggactgcg tggcagtggc tgggcccctc ggggtcacac actttctgat cctgagcaaa acagagacca atgtctactt taagctgatg cgcctcccag gaggccccac cttgaccttc caggtcaaga agtactcgct ggtgcgtgat gtggtctcct cactgcgccg gcaccgcatg cacgagcagc agtttgccca cccacccctc ctggtactca acagctttgg cccccatggt atgcatgtga agctcatggc caccatgttc cagaacctgt tcccctccat caacgtgcac aaggtgaacc tgaacaccat caagcgctgc ctcctcatcg actacaaccc cgactcccag gagctggact tccgccacta tagcatcaaa gttgttcctg tgggcgcgag tcgcgggatg aagaagctgc tccaggagaa gttccccaac atgagccgcc tgcaggacat cagcgagctg ctggccacgg gcgcggggct gtcggagagc gaggcagagc ctgacggcga ccacaacatc acagagctgc ctcaggctgt cgctggccgt ggcaacatgc gggcccagca gagtgcagtg cggctcaccg agatcggccc gcggatgaca ctgcagctca tcaaggtcca ggagggcgtc ggggagggca aagtgatgtt ccacagtttt gtgagcaaga cggaggagga gctgcaggcc atcctggaag ccaaggagaa gaagctgcgg ctgaaggcgc agaggcaggc ccagcaggcc cagaatgtgc agcgcaagca ggagcagcgg gaggcccaca gaaagaagag cctggagggc atgaagaagg cacgggtcgg gggtagtgat gaagaggcct ctgggatccc ttcaaggacg gcgagcctgg agttaggtga ggacgatgat gaacaggaag atgatgacat cgagtatttc tgccaggcgg tgggcgaggc gcccagtgag gacctgttcc ccgaggccaa gcagaaacgg cttgccaagt ctccagggcg gaagcggaag cggtgggaaa tggatcgagg caggggtcgc ctttgtgacc agaagtttcc caagaccaag gacaagtccc agggagccca ggccaggcgg gggcccagag gggcttcccg ggatggtggg cgaggccggg gccggggccg cccagggaag agagtggcct ga. It is sometimes possible for the material contained within the vial of "PPAN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.