Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB17 cdna clone

ZBTB17 cDNA Clone

Gene Names
ZBTB17; MIZ-1; ZNF60; ZNF151; pHZ-67
Synonyms
ZBTB17; ZBTB17 cDNA Clone; ZBTB17 cdna clone
Ordering
For Research Use Only!
Sequence
atggactttccccagcacagccagcatgtcttggaacagctgaaccagcagcggcagctggggcttctctgtgactgcacctttgtggtggacggtgttcactttaaggctcataaagcagtgctggcggcctgcagcgagtacttcaagatgctcttcgtggaccagaaggacgtggtgcacctggacatcagtaacgcggcaggcctggggcaggtgctggagtttatgtacacggccaagctgagcctgagccctgagaacgtggatgatgtgctggccgtggccactttcctccaaatgcaggacatcatcacggcctgccatgccctcaagtcacttgctgagccggctaccagccctgggggaaatgcggaggccttggccacagaaggaggggacaagagagccaaagaggagaaggtggccaccagcacgctgagcaggctggagcaggcaggacgcagcacacccataggccccagcagggacctcaaggaggagcgcggcggtcaggcccagagtgcggccagcggtgcagagcagacagagaaagccgatgcgccccgggagccgccgcctgtggagctcaagccagaccccacgagtggcatggctgctgcagaagctgaggccgctttgtccgagagctcggagcaagaaatggaggtggagcccgcccggaaaggggaagaggagcaaaaggagcaagaggagcaagaggaggagggcgcagggccagctgaggtcaaggaggagggttcccagctggagaacggagaggcccccgaggagaacgagaatgaggagtcagcgggcacagactcggggcaggagctcggctccgaggcccggggcctgcgctcaggcacctacggcgaccgcacggagtccaaggcctacggctccgtcatccacaagtgcgaggactgtgggaaggagttcacgcacacggggaacttcaagcggcacatccgcatccacacgggggagaagcccttctcgtgccgggagtgcagcaaggccttttccgacccggccgcgtgcaaggcccatgagaagacgcacagccctctgaagccctacggctgcgaggagtgcgggaagagctaccgcctcatcagcctgctgaacctgcacaagaagcggcactcgggcgaggcgcgctaccgctgcgaggactgcggcaagctcttcaccacctcgggcaacctcaagcgccaccagctggtgcacagcggcgagaagccctaccagtgcgactactgcggccgctccttctccgaccccacttccaagatgcgccacctggagacccacgacacggacaaggagcacaagtgcccacactgcgacaagaagttcaaccaggtagggaacctgaaggcccacctgaagatccacatcgctgacgggcccctcaagtgccgagagtgtgggaagcagttcaccacctcagggaacctgaagcggcaccttcggatccacagcggggagaagccctacgtgtgcatccactgccagcgacagtttgcagaccccggcgctctgcagcggcacgtccgcattcacacaggtgagaagccatgccagtgtgtgatgtgcggtaaggccttcacccaggccagctccctcatcgcccacgtgcgccagcacaccggggagaagccctacgtctgcgagcgctgcggcaagagattcgtccagtccagccagttggccaatcatattcgccaccacgacaacatccgcccacacaagtgcagcgtgtgcagcaaggccttcgtgaacgtgggggacctgtccaagcacatcatcattcacactggagagaagccttacctgtgtgataagtgtgggcgtggcttcaaccgggtagacaacctgcgctcccacgtgaagaccgtgcaccagggcaaggcaggcatcaagatcctggagcccgaggagggcagtgaggtcagcgtggtcactgtggatgacatggtcacgctggctaccgaggcactggcagcgacagccgtcactcagctcacagtggtgccggtgggagctgcagtgacagccgatgagacggaagtcctgaaggccgagatcagcaaagctgtgaagcaagtgcaggaagaagaccccaacactcacatcctctacgcctgtgactcctgtggggacaagtttctggatgccaacagcctggctcagcatgtgcgaatccacacagcccaggcactggtcatgttccagacagacgcggacttctatcagcagtatgggccaggtggcacgtggcctgccgggcaggtgctgcaggctggggagctggtcttccgccctcgcgacggggctgagggccagcccgcactggcagagacctcccctacagctcctgaatgtcccccgcctgccgagtga
Sequence Length
2412
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,228 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 17, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 17
NCBI Official Symbol
ZBTB17
NCBI Official Synonym Symbols
MIZ-1; ZNF60; ZNF151; pHZ-67
NCBI Protein Information
zinc finger and BTB domain-containing protein 17
UniProt Protein Name
Zinc finger and BTB domain-containing protein 17
UniProt Gene Name
ZBTB17
UniProt Synonym Gene Names
MIZ1; ZNF151; ZNF60; Miz-1
UniProt Entry Name
ZBT17_HUMAN

NCBI Description

This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]

Uniprot Description

ZBTB17: a transcription factor that can function as an activator or repressor depending on its binding partners, and by targeting negative regulators of cell cycle progression. Plays a critical role in early lymphocyte development, where it is essential to prevent apoptosis in lymphoid precursors, allowing them to survive in response to IL7 and undergo proper lineage commitment. Has been shown to bind to the promoters of adenovirus major late protein and cyclin D1 and activate transcription. Required for early embryonic development during gastrulation. Represses RB1 transcription; this repression can be blocked by interaction with ZBTB49 isoform 3/ZNF509S1. Belongs to the krueppel C2H2-type zinc-finger protein family. Binds to the C-terminal helix-loop-helix motif of MYC which inhibits ZBTB17 transactivation and growth arrest activities and renders it insoluble in the nucleus. Also interacts with HCFC1, MAGEA4 and TMPRSS11A. Three isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 1p36.13

Cellular Component: nucleoplasm

Molecular Function: protein binding; transcription factor activity

Biological Process: negative regulation of cell cycle

Research Articles on ZBTB17

Similar Products

Product Notes

The ZBTB17 zbtb17 (Catalog #AAA1271273) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactttc cccagcacag ccagcatgtc ttggaacagc tgaaccagca gcggcagctg gggcttctct gtgactgcac ctttgtggtg gacggtgttc actttaaggc tcataaagca gtgctggcgg cctgcagcga gtacttcaag atgctcttcg tggaccagaa ggacgtggtg cacctggaca tcagtaacgc ggcaggcctg gggcaggtgc tggagtttat gtacacggcc aagctgagcc tgagccctga gaacgtggat gatgtgctgg ccgtggccac tttcctccaa atgcaggaca tcatcacggc ctgccatgcc ctcaagtcac ttgctgagcc ggctaccagc cctgggggaa atgcggaggc cttggccaca gaaggagggg acaagagagc caaagaggag aaggtggcca ccagcacgct gagcaggctg gagcaggcag gacgcagcac acccataggc cccagcaggg acctcaagga ggagcgcggc ggtcaggccc agagtgcggc cagcggtgca gagcagacag agaaagccga tgcgccccgg gagccgccgc ctgtggagct caagccagac cccacgagtg gcatggctgc tgcagaagct gaggccgctt tgtccgagag ctcggagcaa gaaatggagg tggagcccgc ccggaaaggg gaagaggagc aaaaggagca agaggagcaa gaggaggagg gcgcagggcc agctgaggtc aaggaggagg gttcccagct ggagaacgga gaggcccccg aggagaacga gaatgaggag tcagcgggca cagactcggg gcaggagctc ggctccgagg cccggggcct gcgctcaggc acctacggcg accgcacgga gtccaaggcc tacggctccg tcatccacaa gtgcgaggac tgtgggaagg agttcacgca cacggggaac ttcaagcggc acatccgcat ccacacgggg gagaagccct tctcgtgccg ggagtgcagc aaggcctttt ccgacccggc cgcgtgcaag gcccatgaga agacgcacag ccctctgaag ccctacggct gcgaggagtg cgggaagagc taccgcctca tcagcctgct gaacctgcac aagaagcggc actcgggcga ggcgcgctac cgctgcgagg actgcggcaa gctcttcacc acctcgggca acctcaagcg ccaccagctg gtgcacagcg gcgagaagcc ctaccagtgc gactactgcg gccgctcctt ctccgacccc acttccaaga tgcgccacct ggagacccac gacacggaca aggagcacaa gtgcccacac tgcgacaaga agttcaacca ggtagggaac ctgaaggccc acctgaagat ccacatcgct gacgggcccc tcaagtgccg agagtgtggg aagcagttca ccacctcagg gaacctgaag cggcaccttc ggatccacag cggggagaag ccctacgtgt gcatccactg ccagcgacag tttgcagacc ccggcgctct gcagcggcac gtccgcattc acacaggtga gaagccatgc cagtgtgtga tgtgcggtaa ggccttcacc caggccagct ccctcatcgc ccacgtgcgc cagcacaccg gggagaagcc ctacgtctgc gagcgctgcg gcaagagatt cgtccagtcc agccagttgg ccaatcatat tcgccaccac gacaacatcc gcccacacaa gtgcagcgtg tgcagcaagg ccttcgtgaa cgtgggggac ctgtccaagc acatcatcat tcacactgga gagaagcctt acctgtgtga taagtgtggg cgtggcttca accgggtaga caacctgcgc tcccacgtga agaccgtgca ccagggcaag gcaggcatca agatcctgga gcccgaggag ggcagtgagg tcagcgtggt cactgtggat gacatggtca cgctggctac cgaggcactg gcagcgacag ccgtcactca gctcacagtg gtgccggtgg gagctgcagt gacagccgat gagacggaag tcctgaaggc cgagatcagc aaagctgtga agcaagtgca ggaagaagac cccaacactc acatcctcta cgcctgtgac tcctgtgggg acaagtttct ggatgccaac agcctggctc agcatgtgcg aatccacaca gcccaggcac tggtcatgtt ccagacagac gcggacttct atcagcagta tgggccaggt ggcacgtggc ctgccgggca ggtgctgcag gctggggagc tggtcttccg ccctcgcgac ggggctgagg gccagcccgc actggcagag acctccccta cagctcctga atgtcccccg cctgccgagt ga. It is sometimes possible for the material contained within the vial of "ZBTB17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.