Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2B cdna clone

UBE2B cDNA Clone

Gene Names
UBE2B; HR6B; UBC2; HHR6B; RAD6B; E2-17kDa
Synonyms
UBE2B; UBE2B cDNA Clone; UBE2B cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaattttctgaagaatatccaaataaaccaccaactgttaggtttttatccaaaatgtttcatccaaatgtgtatgctgatggtagcatatgtttagatatccttcagaatcgatggagtccaacatatgatgtatcttctatcttaacatcaattcagtctctgctggatgaaccgaatcctaacagtccagccaatagccaggcagcacagctttatcaggaaaacaaacgagaatatgagaaaagagtttcggccattgttgaacaaagctggaatgattcataa
Sequence Length
459
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,312 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2B (RAD6 homolog), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 B
NCBI Official Symbol
UBE2B
NCBI Official Synonym Symbols
HR6B; UBC2; HHR6B; RAD6B; E2-17kDa
NCBI Protein Information
ubiquitin-conjugating enzyme E2 B
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 B
UniProt Gene Name
UBE2B
UniProt Synonym Gene Names
RAD6B; HR6B; hHR6B
UniProt Entry Name
UBE2B_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution. [provided by RefSeq, Jul 2008]

Uniprot Description

UBE2B: a ubiquitin-protein ligase, a member of the ubiquitin-conjugating enzyme family. Homologous to the yeast DNA repair gene RAD6. Interacts with RAD18. Required for postreplication repair of UV-damaged DNA.

Protein type: Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.19; Ligase

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: chromatin; cytoplasm; nuclear chromatin; nucleoplasm; nucleus; replication fork

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: DNA damage response, detection of DNA damage; DNA repair; histone H2A ubiquitination; postreplication repair; proteasomal ubiquitin-dependent protein catabolic process; protein autoubiquitination; protein monoubiquitination; protein polyubiquitination; protein stabilization; protein ubiquitination; response to DNA damage stimulus; response to drug; response to UV; spermatogenesis; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway through beta-catenin

Research Articles on UBE2B

Similar Products

Product Notes

The UBE2B ube2b (Catalog #AAA1271238) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgaccc cggcccggag gaggctcatg cgggatttca agcggttaca agaggaccca cctgtgggtg tcagtggcgc accatctgaa aacaacatca tgcagtggaa tgcagttata tttggaccag aagggacacc ttttgaagat ggtactttta aactagtaat agaattttct gaagaatatc caaataaacc accaactgtt aggtttttat ccaaaatgtt tcatccaaat gtgtatgctg atggtagcat atgtttagat atccttcaga atcgatggag tccaacatat gatgtatctt ctatcttaac atcaattcag tctctgctgg atgaaccgaa tcctaacagt ccagccaata gccaggcagc acagctttat caggaaaaca aacgagaata tgagaaaaga gtttcggcca ttgttgaaca aagctggaat gattcataa. It is sometimes possible for the material contained within the vial of "UBE2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.