Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLCN6 cdna clone

CLCN6 cDNA Clone

Gene Names
CLCN6; CLC-6
Synonyms
CLCN6; CLCN6 cDNA Clone; CLCN6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggtgcagggggtctctgtgctgctgctgcaggtggtgctgctgctgcggtgagcgtgagacccgcacccccgaggagctgaccatccttggagaaacacaggaggaggaggatgagattcttccaaggaaagactatgagagtttggattatgatcgctgtatcaatgacccttacctggaagttttggagaccatggataataagaaaggtcgaagatatgaggcggtgaagtggatggtggtgtttgccattggagtctgcactggcctggtgggtctctttgtggacttttttgtgcgactcttcacccaactcaagttcggagtggtacagacatcggtggaggagtgcagccagaaaggctgcctcgctctgtctctccttgaactcctgggttttaacctcacctttgtcttcctggcaagcctccttgttctcattgagccggtggcagcaggttccgggatacccgaggtcaaatgctatctgaatggcgtaaaggtgccaggaatcgtccgtctccggaccctgctctgcaaggtccttggagtgctgttcagtgtggctggagggctcttcgtggggaaggaaggccccatgatccacagtggttcggtggtgggagctggcctccctcagtttcagagcatctccttacggaagatccagtttaacttcccctatttccgaagcgacagagacaagagagactttgtatcagcaggagcggctgctggagttgctgcagctttcggggcgccaatcgggggtaccttgttcagtctagaggagggttcgtccttctggaaccaagggctcacgtggaaagtgctcttttgttccatgtctgccaccttcaccctcaacttcttccgttctgggattcagtttggaagctggggttccttccagctccctggattgctgaactttggcgagtttaagtgctctgactctgataaaaaatgtcatctctggacagctatggatttgggtttcttcgtcgtgatgggggtcattgggggcctcctgggagccacattcaactgtctgaacaagaggcttgcaaagtaccgtatgcgaaacgtgcacccgaaacctaagctcgtcagagtcttagagagcctccttgtgtctctggtaaccaccgtggtggtgtttgtggcctcgatggtgttaggagaatgccgacagatgtcctcttcgagtcaaatcggtaatgactcattccagctccaggtcacagaagatgtgaattcaagtatcaagacatttttttgtcccaatgatacctacaatgacatggccacactcttcttcaacccgcaggagtctgccatcctccagctcttccaccaggatggtactttcagccccgtcactctggccttgttcttcgttctctatttcttgcttgcatgttggacttacggcatttctgttccaagtggcctttttgtgccttctctgctgtgtggagctgcttttggacgtttagttgccaatgtcctaaaaagctacattggattgggccacatctattcggggacctttgccctgattggtgcagcggctttcttgggcggggtggtccgcatgaccatcagcctcacggtcatcctgatcgagtccaccaatgagatcacctacgggctccccatcatggtcacactgatggtggccaaatggacaggggactttttcaataagggcatttatgatatccacgtgggcctgcgaggcgtgccgcttctggaatgggagacagaggtggaaatggacaagctgagagccagcgacatcatggagcccaacctgacctacgtctacccgcacacccgcatccagtctctggtgagcatcctgcgcaccacggtccaccatgccttcccggtggtcacagagaaccgcggtaacgagaaggagttcatgaagggcaaccagctcatcagcaacaacatcaagttcaagaaatccagcatcctcacccgggctggcgagcagcgcaaacggagccagtccatgaagtcctacccatccagcgagctacggaacatgtgtgatgagcacatcgcctctgaggagccagccgagaaggaggacctcctgcagcagatgctggaaaggagatacactccctaccccaacctataccctgaccagtccccaagtgaagactggaccatggaggagcggttccgccctctgaccttccacggcctgatccttcggtcgcagcttgtcaccctgcttgtccgaggagtttgttactctgaaagccagtcgagcgccagccagccgcgcctctcctatgccgagatggccgaggactacccgcggtaccccgacatccacgacctggacctgacgctgctcaacccgcgcatgatcgtggatgtcaccccatacatgaacccttcgcctttcaccgtctcgcccaacacccacgtctcccaagtcttcaacctgttcagaacgatgggcctgcgccacctgcccgtggtgaacgctgtgggagagatcgtggggatcatcacacggcacaacctcacctatgaatttctgcaggcccggctgaggcagcactaccagaccatctga
Sequence Length
2610
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
94,660 Da
NCBI Official Full Name
Homo sapiens chloride channel 6, mRNA
NCBI Official Synonym Full Names
chloride voltage-gated channel 6
NCBI Official Symbol
CLCN6
NCBI Official Synonym Symbols
CLC-6
NCBI Protein Information
chloride transport protein 6
UniProt Protein Name
Chloride transport protein 6
UniProt Gene Name
CLCN6
UniProt Synonym Gene Names
KIAA0046; ClC-6
UniProt Entry Name
CLCN6_HUMAN

NCBI Description

This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012]

Uniprot Description

CLCN6: Chloride transport protein, initially identified as voltage-gated chloride channel. The presence of the conserved gating glutamate residues suggests that is functions as antiporter. Belongs to the chloride channel (TC 2.A.49) family. ClC-6/CLCN6 subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, chloride; Transporter; Membrane protein, integral; Membrane protein, multi-pass; Transporter, ion channel

Chromosomal Location of Human Ortholog: 1p36

Cellular Component: endosome membrane; lysosomal membrane

Molecular Function: antiporter activity; chloride ion binding; voltage-gated chloride channel activity

Research Articles on CLCN6

Similar Products

Product Notes

The CLCN6 clcn6 (Catalog #AAA1271171) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggt gcagggggtc tctgtgctgc tgctgcaggt ggtgctgctg ctgcggtgag cgtgagaccc gcacccccga ggagctgacc atccttggag aaacacagga ggaggaggat gagattcttc caaggaaaga ctatgagagt ttggattatg atcgctgtat caatgaccct tacctggaag ttttggagac catggataat aagaaaggtc gaagatatga ggcggtgaag tggatggtgg tgtttgccat tggagtctgc actggcctgg tgggtctctt tgtggacttt tttgtgcgac tcttcaccca actcaagttc ggagtggtac agacatcggt ggaggagtgc agccagaaag gctgcctcgc tctgtctctc cttgaactcc tgggttttaa cctcaccttt gtcttcctgg caagcctcct tgttctcatt gagccggtgg cagcaggttc cgggataccc gaggtcaaat gctatctgaa tggcgtaaag gtgccaggaa tcgtccgtct ccggaccctg ctctgcaagg tccttggagt gctgttcagt gtggctggag ggctcttcgt ggggaaggaa ggccccatga tccacagtgg ttcggtggtg ggagctggcc tccctcagtt tcagagcatc tccttacgga agatccagtt taacttcccc tatttccgaa gcgacagaga caagagagac tttgtatcag caggagcggc tgctggagtt gctgcagctt tcggggcgcc aatcgggggt accttgttca gtctagagga gggttcgtcc ttctggaacc aagggctcac gtggaaagtg ctcttttgtt ccatgtctgc caccttcacc ctcaacttct tccgttctgg gattcagttt ggaagctggg gttccttcca gctccctgga ttgctgaact ttggcgagtt taagtgctct gactctgata aaaaatgtca tctctggaca gctatggatt tgggtttctt cgtcgtgatg ggggtcattg ggggcctcct gggagccaca ttcaactgtc tgaacaagag gcttgcaaag taccgtatgc gaaacgtgca cccgaaacct aagctcgtca gagtcttaga gagcctcctt gtgtctctgg taaccaccgt ggtggtgttt gtggcctcga tggtgttagg agaatgccga cagatgtcct cttcgagtca aatcggtaat gactcattcc agctccaggt cacagaagat gtgaattcaa gtatcaagac atttttttgt cccaatgata cctacaatga catggccaca ctcttcttca acccgcagga gtctgccatc ctccagctct tccaccagga tggtactttc agccccgtca ctctggcctt gttcttcgtt ctctatttct tgcttgcatg ttggacttac ggcatttctg ttccaagtgg cctttttgtg ccttctctgc tgtgtggagc tgcttttgga cgtttagttg ccaatgtcct aaaaagctac attggattgg gccacatcta ttcggggacc tttgccctga ttggtgcagc ggctttcttg ggcggggtgg tccgcatgac catcagcctc acggtcatcc tgatcgagtc caccaatgag atcacctacg ggctccccat catggtcaca ctgatggtgg ccaaatggac aggggacttt ttcaataagg gcatttatga tatccacgtg ggcctgcgag gcgtgccgct tctggaatgg gagacagagg tggaaatgga caagctgaga gccagcgaca tcatggagcc caacctgacc tacgtctacc cgcacacccg catccagtct ctggtgagca tcctgcgcac cacggtccac catgccttcc cggtggtcac agagaaccgc ggtaacgaga aggagttcat gaagggcaac cagctcatca gcaacaacat caagttcaag aaatccagca tcctcacccg ggctggcgag cagcgcaaac ggagccagtc catgaagtcc tacccatcca gcgagctacg gaacatgtgt gatgagcaca tcgcctctga ggagccagcc gagaaggagg acctcctgca gcagatgctg gaaaggagat acactcccta ccccaaccta taccctgacc agtccccaag tgaagactgg accatggagg agcggttccg ccctctgacc ttccacggcc tgatccttcg gtcgcagctt gtcaccctgc ttgtccgagg agtttgttac tctgaaagcc agtcgagcgc cagccagccg cgcctctcct atgccgagat ggccgaggac tacccgcggt accccgacat ccacgacctg gacctgacgc tgctcaaccc gcgcatgatc gtggatgtca ccccatacat gaacccttcg cctttcaccg tctcgcccaa cacccacgtc tcccaagtct tcaacctgtt cagaacgatg ggcctgcgcc acctgcccgt ggtgaacgct gtgggagaga tcgtggggat catcacacgg cacaacctca cctatgaatt tctgcaggcc cggctgaggc agcactacca gaccatctga. It is sometimes possible for the material contained within the vial of "CLCN6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.