Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ETS1 cdna clone

ETS1 cDNA Clone

Gene Names
ETS1; p54; ETS-1; EWSR2; c-ets-1
Synonyms
ETS1; ETS1 cDNA Clone; ETS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggcggccgtcgatctcaagccgactctcaccatcatcaagacggaaaaagtcgatctggagcttttcccctccccggatatggaatgtgcagatgtcccactattaactccaagcagcaaagaaatgatgtctcaagcattaaaagctactttcagtggtttcactaaagaacagcaacgactggggatcccaaaagacccccggcagtggacagaaacccatgttcgggactgggtgatgtgggctgtgaatgaattcagcctgaaaggtgtagacttccagaagttctgtatgaatggagcagccctctgcgccctgggtaaagactgctttctcgagctggccccagactttgttggggacatcttatgggaacatctagagatcctgcagaaagaggatgtgaaaccatatcaagttaatggagtcaacccagcctatccagaatcccgctatacctcggattacttcattagctatggtattgagcatgcccagtgtgttccaccatcggagttctcagagcccagcttcatcacagagtcctatcagacgctccatcccatcagctcggaagagctcctctccctcaagtatgagaatgactacccctcggtcattctccgagaccctctccagacagacaccttgcagaatgactactttgctatcaaacaagaagtcgtcaccccagacaacatgtgcatggggaggaccagtcgtggtaaactcgggggccaggactcttttgaaagcatagagagctacgatagttgtggccaggagatggggaaagaggaaaaacaaacctaa
Sequence Length
819
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,860 Da
NCBI Official Full Name
Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian), mRNA
NCBI Official Synonym Full Names
ETS proto-oncogene 1, transcription factor
NCBI Official Symbol
ETS1
NCBI Official Synonym Symbols
p54; ETS-1; EWSR2; c-ets-1
NCBI Protein Information
protein C-ets-1
UniProt Protein Name
Protein C-ets-1
Protein Family
UniProt Gene Name
ETS1
UniProt Synonym Gene Names
EWSR2
UniProt Entry Name
ETS1_HUMAN

NCBI Description

This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]

Uniprot Description

Ets-1: a proto-oncogenic transcription factor homologous to the v-ets erythroblastosis virus oncogene. The DNA binding activity of Ets1 is controlled by kinases and transcription factors. It contributes to the regulation of cellular differentiation in hematopoietic cells. Ets1 promotes invasive behavior in endothelial cells, vascular smooth muscle cells and epithelial cancer cells. Regulates the expression of MMP1, MMP3, MMP9 and uPA as well as of VEGF and VEGFR gene expression. Two alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Transcription factor; Oncoprotein; DNA-binding

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA binding; identical protein binding; protein binding; transcription factor activity

Biological Process: cell motility involved in cell locomotion; immune response; negative regulation of cell proliferation; PML body organization and biogenesis; positive regulation of cell motility; positive regulation of erythrocyte differentiation; positive regulation of inflammatory response; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of angiogenesis

Research Articles on ETS1

Similar Products

Product Notes

The ETS1 ets1 (Catalog #AAA1271142) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcgg ccgtcgatct caagccgact ctcaccatca tcaagacgga aaaagtcgat ctggagcttt tcccctcccc ggatatggaa tgtgcagatg tcccactatt aactccaagc agcaaagaaa tgatgtctca agcattaaaa gctactttca gtggtttcac taaagaacag caacgactgg ggatcccaaa agacccccgg cagtggacag aaacccatgt tcgggactgg gtgatgtggg ctgtgaatga attcagcctg aaaggtgtag acttccagaa gttctgtatg aatggagcag ccctctgcgc cctgggtaaa gactgctttc tcgagctggc cccagacttt gttggggaca tcttatggga acatctagag atcctgcaga aagaggatgt gaaaccatat caagttaatg gagtcaaccc agcctatcca gaatcccgct atacctcgga ttacttcatt agctatggta ttgagcatgc ccagtgtgtt ccaccatcgg agttctcaga gcccagcttc atcacagagt cctatcagac gctccatccc atcagctcgg aagagctcct ctccctcaag tatgagaatg actacccctc ggtcattctc cgagaccctc tccagacaga caccttgcag aatgactact ttgctatcaa acaagaagtc gtcaccccag acaacatgtg catggggagg accagtcgtg gtaaactcgg gggccaggac tcttttgaaa gcatagagag ctacgatagt tgtggccagg agatggggaa agaggaaaaa caaacctaa. It is sometimes possible for the material contained within the vial of "ETS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.