Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC42 cdna clone

CDC42 cDNA Clone

Gene Names
CDC42; TKS; G25K; CDC42Hs
Synonyms
CDC42; CDC42 cDNA Clone; CDC42 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgcagggcaagaggattatgacagattacgaccgctgagttatccacaaacagatgtatttctagtctgtttttcagtggtctctccatcttcatttgaaaacgtgaaagaaaagtgggtgcctgagataactcaccactgtccaaagactcctttcttgcttgttgggactcaaattgatctcagagatgacccctctactattgagaaacttgccaagaacaaacagaagcctatcactccagagactgctgaaaagctggcccgtgacctgaaggctgtcaagtatgtggagtgttctgcacttacacagaaaggcctaaagaatgtatttgacgaagcaatattggctgccctggagcctccagaaccgaagaagagccgcaggtgtgtgctgctatga
Sequence Length
576
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
998
Molecular Weight
21,311 Da
NCBI Official Full Name
Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa), mRNA
NCBI Official Synonym Full Names
cell division cycle 42
NCBI Official Symbol
CDC42
NCBI Official Synonym Symbols
TKS; G25K; CDC42Hs
NCBI Protein Information
cell division control protein 42 homolog
UniProt Protein Name
Cell division control protein 42 homolog
Protein Family
UniProt Gene Name
CDC42
UniProt Entry Name
CDC42_HUMAN

NCBI Description

The protein encoded by this gene is a small GTPase of the Rho-subfamily, which regulates signaling pathways that control diverse cellular functions including cell morphology, migration, endocytosis and cell cycle progression. This protein is highly similar to Saccharomyces cerevisiae Cdc 42, and is able to complement the yeast cdc42-1 mutant. The product of oncogene Dbl was reported to specifically catalyze the dissociation of GDP from this protein. This protein could regulate actin polymerization through its direct binding to Neural Wiskott-Aldrich syndrome protein (N-WASP), which subsequently activates Arp2/3 complex. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes of this gene have been identified on chromosomes 3, 4, 5, 7, 8 and 20. [provided by RefSeq, Apr 2013]

Research Articles on CDC42

Similar Products

Product Notes

The CDC42 cdc42 (Catalog #AAA1271132) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagacaa ttaagtgtgt tgttgtgggc gatggtgctg ttggtaaaac atgtctcctg atatcctaca caacaaacaa atttccatcg gaatatgtac cgactgtttt tgacaactat gcagtcacag ttatgattgg tggagaacca tatactcttg gactttttga tactgcaggg caagaggatt atgacagatt acgaccgctg agttatccac aaacagatgt atttctagtc tgtttttcag tggtctctcc atcttcattt gaaaacgtga aagaaaagtg ggtgcctgag ataactcacc actgtccaaa gactcctttc ttgcttgttg ggactcaaat tgatctcaga gatgacccct ctactattga gaaacttgcc aagaacaaac agaagcctat cactccagag actgctgaaa agctggcccg tgacctgaag gctgtcaagt atgtggagtg ttctgcactt acacagaaag gcctaaagaa tgtatttgac gaagcaatat tggctgccct ggagcctcca gaaccgaaga agagccgcag gtgtgtgctg ctatga. It is sometimes possible for the material contained within the vial of "CDC42, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.