MBOAT2 cdna clone
MBOAT2 cDNA Clone
Gene Names
MBOAT2; LPAAT; LPEAT; OACT2; LPCAT4; LPLAT 2
Synonyms
MBOAT2; MBOAT2 cDNA Clone; MBOAT2 cdna clone
Sequence
atgccaagcttactggagtatttgagttacaactgtaacttcatggggatcctggcaggcccactttgctcttacaaagactacattactttcattgaaggcagatcataccatatcacacaatctggtgaaaatggaaaagaagagacacagtatgaaagaacagagccatctccaaatactgcggttgttcagaagctcttagtttgtgggctgtccttgttatttcacttgaccatctgtacaacattacctgtggagtacaacattgatgagcattttcaagctacagcttcgtggccaacaaagattatctatctgtatatctctcttttggctgccagacccaaatactattttgcatggacgctagctgatgccattaataatgctgcaggctttggtttcagagggtatgacgaaaatggagcagctcgctgggacttaatttccaatttgagaattcaacaaatagagatgtcaacaagtttcaagatgtttcttgataattggaatattcagacagctctttggctcaaaagggtgtgttatgaacgaacctccttcagtccaactatccagacgttcattctctctgccatttggcacggggtatacccaggatattatctaacgtttctaacaggggtgttaatgacattagcagcaagagctatgagaaataactttagacattatttcattgaaccttcccaactgaaattattttatgatgttataacatggatagtaactcaagtagcaataagttacacagttgtgccatttgtgcttctttctataaaaccatcactcacgttttacagctcctggtattattgcctgcacattcttggtatcttagtattattgttgttgccagtgaaaaaaactcaaagaagaaagaatacacatgaaaacattcagctctcacaatccaaaaagtttgatgaaggagaaaattctttgggacagaacagtttttctacaacaaacaatgtttgcaatcagaatcaagaaatagcctcgagacattcatcactaaagcagtga
Sequence Length
1053
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,527 Da
NCBI Official Full Name
Homo sapiens membrane bound O-acyltransferase domain containing 2, mRNA
NCBI Official Synonym Full Names
membrane bound O-acyltransferase domain containing 2
NCBI Official Symbol
MBOAT2
NCBI Official Synonym Symbols
LPAAT; LPEAT; OACT2; LPCAT4; LPLAT 2
NCBI Protein Information
lysophospholipid acyltransferase 2
UniProt Protein Name
Lysophospholipid acyltransferase 2
Protein Family
UniProt Gene Name
MBOAT2
UniProt Synonym Gene Names
OACT2; LPLAT 2; LPAAT; Lyso-PA acyltransferase; LPEAT; Lyso-PE acyltransferase; O-acyltransferase domain-containing protein 2
UniProt Entry Name
MBOA2_HUMAN
Uniprot Description
MBOAT2: Acyltransferase which mediates the conversion of lysophosphatidylethanolamine (1-acyl-sn-glycero-3- phosphoethanolamine or LPE) into phosphatidylethanolamine (1,2- diacyl-sn-glycero-3-phosphoethanolamine or PE) (LPEAT activity). Catalyzes also the acylation of lysophosphatidic acid (LPA) into phosphatidic acid (PA) (LPAAT activity). Has also a very weak lysophosphatidylcholine acyltransferase (LPCAT activity). Prefers oleoyl-CoA as the acyl donor. Lysophospholipid acyltransferases (LPLATs) catalyze the reacylation step of the phospholipid remodeling pathway also known as the Lands cycle. Belongs to the membrane-bound acyltransferase family.
Protein type: EC 2.3.1.51; Membrane protein, multi-pass; Transferase; EC 2.3.1.n7; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2p25.1
Cellular Component: endoplasmic reticulum membrane
Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; 2-acylglycerol-3-phosphate O-acyltransferase activity
Similar Products
Product Notes
The MBOAT2 mboat2 (Catalog #AAA1271062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaagct tactggagta tttgagttac aactgtaact tcatggggat cctggcaggc ccactttgct cttacaaaga ctacattact ttcattgaag gcagatcata ccatatcaca caatctggtg aaaatggaaa agaagagaca cagtatgaaa gaacagagcc atctccaaat actgcggttg ttcagaagct cttagtttgt gggctgtcct tgttatttca cttgaccatc tgtacaacat tacctgtgga gtacaacatt gatgagcatt ttcaagctac agcttcgtgg ccaacaaaga ttatctatct gtatatctct cttttggctg ccagacccaa atactatttt gcatggacgc tagctgatgc cattaataat gctgcaggct ttggtttcag agggtatgac gaaaatggag cagctcgctg ggacttaatt tccaatttga gaattcaaca aatagagatg tcaacaagtt tcaagatgtt tcttgataat tggaatattc agacagctct ttggctcaaa agggtgtgtt atgaacgaac ctccttcagt ccaactatcc agacgttcat tctctctgcc atttggcacg gggtataccc aggatattat ctaacgtttc taacaggggt gttaatgaca ttagcagcaa gagctatgag aaataacttt agacattatt tcattgaacc ttcccaactg aaattatttt atgatgttat aacatggata gtaactcaag tagcaataag ttacacagtt gtgccatttg tgcttctttc tataaaacca tcactcacgt tttacagctc ctggtattat tgcctgcaca ttcttggtat cttagtatta ttgttgttgc cagtgaaaaa aactcaaaga agaaagaata cacatgaaaa cattcagctc tcacaatcca aaaagtttga tgaaggagaa aattctttgg gacagaacag tttttctaca acaaacaatg tttgcaatca gaatcaagaa atagcctcga gacattcatc actaaagcag tga. It is sometimes possible for the material contained within the vial of "MBOAT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
