GTDC1 cdna clone
GTDC1 cDNA Clone
Gene Names
GTDC1; mat-Xa; Hmat-Xa
Synonyms
GTDC1; GTDC1 cDNA Clone; GTDC1 cdna clone
Sequence
atgagtatcctcatcattgaagcattctatggaggctcccataaacagctggtggatcttcttcaagaagagttaggagactgtgtcgtttatacccttcctgcaaagaaatggcattggagagcccggacatctgctttatatttctctcagaccattcccatcagtgagcattacaggaccctctttgcaagttcagtgcttaacctgaccgaactggctgcccttcggcctgaccttgggaaactgaaaaagattctgtattttcacgagaaccagttgatatatcctgtcaagaaatgtcaggagagggatttccaatatggatacaaccaaattctttcatgcctggtggctgatgtggttgtattcaactcagtttttaatatggaatcatttctcacttccatgggaaaatttatgaagctgattcctgatcacagacccaaggatctggaaagcatcatcagacccaagtgccaagttatttactttcccatcaggtttcctgatgtgagcagattcatgcccaagcacaaaacaacccatttaaagaagatgctcggccttaaaggaaatggcggtgcggttctgtccatggcccttccttttcagccagagcagagagattcagaggatttattgaagaattttaattcagagtgtgatacacactgtggccttgatactgcacgacaagaatatttgggtaactcattaagacaggaatcagacttgaaaaaatccacctcgtcagataattcaagctctcatcatggtgaaaataaacaaaatctgactgttgatccctgtgacattttgggtggagttgataatcagcaaagactgctacacattgtctggcctcacaggtggtaa
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,681 Da
NCBI Official Full Name
Homo sapiens glycosyltransferase-like domain containing 1, mRNA
NCBI Official Synonym Full Names
glycosyltransferase like domain containing 1
NCBI Official Symbol
GTDC1
NCBI Official Synonym Symbols
mat-Xa; Hmat-Xa
NCBI Protein Information
glycosyltransferase-like domain-containing protein 1
UniProt Protein Name
Glycosyltransferase-like domain-containing protein 1
Protein Family
UniProt Gene Name
GTDC1
UniProt Entry Name
GTDC1_HUMAN
Uniprot Description
GTDC1: Belongs to the glycosyltransferase group 1 family. Glycosyltransferase 4 subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2q22.3
Research Articles on GTDC1
Similar Products
Product Notes
The GTDC1 gtdc1 (Catalog #AAA1271029) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtatcc tcatcattga agcattctat ggaggctccc ataaacagct ggtggatctt cttcaagaag agttaggaga ctgtgtcgtt tatacccttc ctgcaaagaa atggcattgg agagcccgga catctgcttt atatttctct cagaccattc ccatcagtga gcattacagg accctctttg caagttcagt gcttaacctg accgaactgg ctgcccttcg gcctgacctt gggaaactga aaaagattct gtattttcac gagaaccagt tgatatatcc tgtcaagaaa tgtcaggaga gggatttcca atatggatac aaccaaattc tttcatgcct ggtggctgat gtggttgtat tcaactcagt ttttaatatg gaatcatttc tcacttccat gggaaaattt atgaagctga ttcctgatca cagacccaag gatctggaaa gcatcatcag acccaagtgc caagttattt actttcccat caggtttcct gatgtgagca gattcatgcc caagcacaaa acaacccatt taaagaagat gctcggcctt aaaggaaatg gcggtgcggt tctgtccatg gcccttcctt ttcagccaga gcagagagat tcagaggatt tattgaagaa ttttaattca gagtgtgata cacactgtgg ccttgatact gcacgacaag aatatttggg taactcatta agacaggaat cagacttgaa aaaatccacc tcgtcagata attcaagctc tcatcatggt gaaaataaac aaaatctgac tgttgatccc tgtgacattt tgggtggagt tgataatcag caaagactgc tacacattgt ctggcctcac aggtggtaa. It is sometimes possible for the material contained within the vial of "GTDC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
