Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WAPAL cdna clone

WAPAL cDNA Clone

Gene Names
WAPL; FOE; WAPAL; KIAA0261
Synonyms
WAPAL; WAPAL cDNA Clone; WAPAL cdna clone
Ordering
For Research Use Only!
Sequence
atggatcttgatagagctagcttagatctaatgattcgacttttggaactggaacaagatgcttcatcagccaagctactgaatgaaaaagacatgaacaaaattaaagaaaaaatccgaaggctctgtgaaactgtacacaacaagcatcttgatctagaaaatataacgactgggcatttagctatggagacattattatcccttacttctaaacgagcaggagactggtttaaagaagaactccggcttttgggtggtctggatcatattgtagataaagtaaaagaatgtgtggatcatttaagtagagatgaggatgaagagaaactggtagcctcactatggggagcagagagatgtttacgagttttagaaagtgtaactgtgcataatcccgaaaatcaaagctacttgatagcatataaagattcccaacttattgtttcatcagctaaagcattacagcattgtgaagaactgattcagcagtacaaccgtgctgaggacagcatatgcttagctgacagtaagcctctgcctcaccagaatgtaactaaccatgtaggcaaagcagtggaggactgcatgagggccatcatcggggtgttgcttaatttaactaatgataatgagtggggcagcaccaaaacaggagagcaggacggtctcataggcacagcgctgaactgtgtgcttcaggttccaaagtacctacctcaggagcagagatttgatattcgagtgctgctattccttgagcgagagcgggcagcccagctagcagaaagtaaaacagatgagttgatcaaagatgctcccaccactcagcatgataagagtggagagtggcaagaaacaagtggagaaatacagtgggtgtcaactgaaaagactgatggtacagaagagaaacataagaaggaggaggaggatgaagaacttgacctcaataaagcccttcagcatgccggcaaacacatggaggattgcattgtggcctcctacacggcactacttcttgggtgtctctgccaggaaagtccaatcaatgtaaccactgtgcgggaatatctgccagaaggagacttttcaataatgacagagatgctcaaaaaatttttgagttttatgaatctcacttgtgctgttggaacaactggccagaaatctatctctagagtgattgaatatttggaacattgctag
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
142,525 Da
NCBI Official Full Name
Homo sapiens wings apart-like homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
WAPL cohesin release factor
NCBI Official Symbol
WAPL
NCBI Official Synonym Symbols
FOE; WAPAL; KIAA0261
NCBI Protein Information
wings apart-like protein homolog
UniProt Protein Name
Wings apart-like protein homolog
UniProt Gene Name
WAPL
UniProt Entry Name
WAPL_HUMAN

Uniprot Description

WAPL: a chromatin-associated protein partner of Epstein-Barr nuclear protein 2. Associated with cervical carcinogenesis and tumor progression.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 10q23.2

Cellular Component: chromatin; chromosome; chromosome, pericentric region; cohesin complex; cytoplasm; cytosol; intracellular membrane-bound organelle; microtubule cytoskeleton; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: meiotic chromosome segregation; mitotic sister chromatid cohesion; negative regulation of DNA replication; negative regulation of sister chromatid cohesion; sister chromatid cohesion

Research Articles on WAPAL

Similar Products

Product Notes

The WAPAL wapl (Catalog #AAA1270994) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcttg atagagctag cttagatcta atgattcgac ttttggaact ggaacaagat gcttcatcag ccaagctact gaatgaaaaa gacatgaaca aaattaaaga aaaaatccga aggctctgtg aaactgtaca caacaagcat cttgatctag aaaatataac gactgggcat ttagctatgg agacattatt atcccttact tctaaacgag caggagactg gtttaaagaa gaactccggc ttttgggtgg tctggatcat attgtagata aagtaaaaga atgtgtggat catttaagta gagatgagga tgaagagaaa ctggtagcct cactatgggg agcagagaga tgtttacgag ttttagaaag tgtaactgtg cataatcccg aaaatcaaag ctacttgata gcatataaag attcccaact tattgtttca tcagctaaag cattacagca ttgtgaagaa ctgattcagc agtacaaccg tgctgaggac agcatatgct tagctgacag taagcctctg cctcaccaga atgtaactaa ccatgtaggc aaagcagtgg aggactgcat gagggccatc atcggggtgt tgcttaattt aactaatgat aatgagtggg gcagcaccaa aacaggagag caggacggtc tcataggcac agcgctgaac tgtgtgcttc aggttccaaa gtacctacct caggagcaga gatttgatat tcgagtgctg ctattccttg agcgagagcg ggcagcccag ctagcagaaa gtaaaacaga tgagttgatc aaagatgctc ccaccactca gcatgataag agtggagagt ggcaagaaac aagtggagaa atacagtggg tgtcaactga aaagactgat ggtacagaag agaaacataa gaaggaggag gaggatgaag aacttgacct caataaagcc cttcagcatg ccggcaaaca catggaggat tgcattgtgg cctcctacac ggcactactt cttgggtgtc tctgccagga aagtccaatc aatgtaacca ctgtgcggga atatctgcca gaaggagact tttcaataat gacagagatg ctcaaaaaat ttttgagttt tatgaatctc acttgtgctg ttggaacaac tggccagaaa tctatctcta gagtgattga atatttggaa cattgctag. It is sometimes possible for the material contained within the vial of "WAPAL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.