Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAF11 cdna clone

TAF11 cDNA Clone

Gene Names
TAF11; TAF2I; PRO2134; TAFII28; MGC:15243
Synonyms
TAF11; TAF11 cDNA Clone; TAF11 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgatgcccacgagtcgccctccgacaaaggtggagagacaggggagtcggatgagacggccgctgtgcccggggacccgggggctaccgacaccgatggaatcccagaggaaactgacggagacgcagatgtggacttgaaagaagctgcagcggaggaaggcgagctcgagagtcaggatgtctcagatttaacaacagttgaaagggaagactcatcattacttaatcctgcagccaaaaaactgaaaatagataccaaagaaaagaaagagaaaaagcagaaagtagatgaagatgagattcagaagatgcaaatcctggtttcttctttttctgaggagcagctgaaccgttatgaaatgtatcgccgctcagctttccctaaggcagccatcaaaaggctgatccagtccatcactggcacctctgtgtctcagaatgttgttattgctatgtctggtatttccaaggttttcgtcggggaggtggtagaagaagcactggatgtgtgtgagaagtggggagaaatgccaccactacaacccaaacatatgagggaagccgttagaaggttaaagtcaaaaggacagatccctaactcgaagcacaaaaaaatcatcttcttctag
Sequence Length
636
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,142 Da
NCBI Official Full Name
Homo sapiens TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein associated factor 11
NCBI Official Symbol
TAF11
NCBI Official Synonym Symbols
TAF2I; PRO2134; TAFII28; MGC:15243
NCBI Protein Information
transcription initiation factor TFIID subunit 11
UniProt Protein Name
Transcription initiation factor TFIID subunit 11
UniProt Gene Name
TAF11
UniProt Synonym Gene Names
TAF2I; TAF(II)28; TAFII-28; TAFII28
UniProt Entry Name
TAF11_HUMAN

NCBI Description

Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit of TFIID that is present in all TFIID complexes and interacts with TBP. This subunit also interacts with another small subunit, TAF13, to form a heterodimer with a structure similar to the histone core structure. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

TAF11: a TBP-associated factor (TAF). A component of TFIID complexes composed of the TATA binding protein (TBP), TAF13 and TAF11. TAF10 and TAF13 contain non-canonical histone folds, forming a histone-like pair in TFIID complexes.

Protein type: DNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 6p21.31

Cellular Component: Golgi apparatus; nucleoplasm; transcription factor TFIID complex

Molecular Function: protein binding; protein N-terminus binding; thyroid hormone receptor binding; transcription coactivator activity; vitamin D receptor binding

Biological Process: RNA elongation from RNA polymerase II promoter; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; transcriptional preinitiation complex assembly

Similar Products

Product Notes

The TAF11 taf11 (Catalog #AAA1270920) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgatg cccacgagtc gccctccgac aaaggtggag agacagggga gtcggatgag acggccgctg tgcccgggga cccgggggct accgacaccg atggaatccc agaggaaact gacggagacg cagatgtgga cttgaaagaa gctgcagcgg aggaaggcga gctcgagagt caggatgtct cagatttaac aacagttgaa agggaagact catcattact taatcctgca gccaaaaaac tgaaaataga taccaaagaa aagaaagaga aaaagcagaa agtagatgaa gatgagattc agaagatgca aatcctggtt tcttcttttt ctgaggagca gctgaaccgt tatgaaatgt atcgccgctc agctttccct aaggcagcca tcaaaaggct gatccagtcc atcactggca cctctgtgtc tcagaatgtt gttattgcta tgtctggtat ttccaaggtt ttcgtcgggg aggtggtaga agaagcactg gatgtgtgtg agaagtgggg agaaatgcca ccactacaac ccaaacatat gagggaagcc gttagaaggt taaagtcaaa aggacagatc cctaactcga agcacaaaaa aatcatcttc ttctag. It is sometimes possible for the material contained within the vial of "TAF11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.