Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP3K3 cdna clone

MAP3K3 cDNA Clone

Gene Names
MAP3K3; MEKK3; MAPKKK3
Synonyms
MAP3K3; MAP3K3 cDNA Clone; MAP3K3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgaagcaaatgtcatgctgccttattcagggaaggaggagcctgtcctgcctgtggccatgaccctgcctctcccaggcaggggcccgcgatgtggaactgctgccactgaggggggatccagttttgtcaatgcagttgtctctgttttacaagttggagtcactcttatgctgtacccagtttctaaactggagactgtgtgtgccctctgggctctgagtacccctgctttgggcttgggcctaggctgcattgaaaagagctga
Sequence Length
273
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,089 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase kinase 3, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase kinase 3
NCBI Official Symbol
MAP3K3
NCBI Official Synonym Symbols
MEKK3; MAPKKK3
NCBI Protein Information
mitogen-activated protein kinase kinase kinase 3
UniProt Protein Name
Mitogen-activated protein kinase kinase kinase 3
UniProt Gene Name
MAP3K3
UniProt Synonym Gene Names
MAPKKK3; MEKK3; MEK kinase 3; MEKK 3
UniProt Entry Name
M3K3_HUMAN

NCBI Description

This gene product is a 626-amino acid polypeptide that is 96.5% identical to mouse Mekk3. Its catalytic domain is closely related to those of several other kinases, including mouse Mekk2, tobacco NPK, and yeast Ste11. Northern blot analysis revealed a 4.6-kb transcript that appears to be ubiquitously expressed. This protein directly regulates the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by activating SEK and MEK1/2 respectively; it does not regulate the p38 pathway. In cotransfection assays, it enhanced transcription from a nuclear factor kappa-B (NFKB)-dependent reporter gene, consistent with a role in the SAPK pathway. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Uniprot Description

MEKK3: a protein kinase of the STE11 family. Phosphorylated and activated by MLK3 and TAK1. Phosphorylates and activates MEK5.

Protein type: EC 2.7.11.25; Kinase, protein; Protein kinase, STE; Protein kinase, Ser/Thr (non-receptor); STE group; STE11 family

Chromosomal Location of Human Ortholog: 17q23.3

Cellular Component: cytoplasm; cytosol

Molecular Function: protein binding; protein kinase activity

Biological Process: MAPKKK cascade; positive regulation of I-kappaB kinase/NF-kappaB cascade; protein amino acid autophosphorylation

Research Articles on MAP3K3

Similar Products

Product Notes

The MAP3K3 map3k3 (Catalog #AAA1270862) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaag caaatgtcat gctgccttat tcagggaagg aggagcctgt cctgcctgtg gccatgaccc tgcctctccc aggcaggggc ccgcgatgtg gaactgctgc cactgagggg ggatccagtt ttgtcaatgc agttgtctct gttttacaag ttggagtcac tcttatgctg tacccagttt ctaaactgga gactgtgtgt gccctctggg ctctgagtac ccctgctttg ggcttgggcc taggctgcat tgaaaagagc tga. It is sometimes possible for the material contained within the vial of "MAP3K3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.