Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD40LG cdna clone

CD40LG cDNA Clone

Gene Names
CD40LG; IGM; IMD3; TRAP; gp39; CD154; CD40L; HIGM1; T-BAM; TNFSF5; hCD40L
Synonyms
CD40LG; CD40LG cDNA Clone; CD40LG cdna clone
Ordering
For Research Use Only!
Sequence
atgatcgaaacatacaaccaaacttctccccgatctgcggccactggactgcccatcagcatgaaaatttttatgtatttacttactgtttttcttatcacccagatgattgggtcagcactttttgctgtgtatcttcatagaaggttggacaagatagaagatgaaaggaatcttcatgaagattttgtattcatgaaaacgatacagagatgcaacacaggagaaagatccttatccttactgaactgtgaggagattaaaagccagtttgaaggctttgtgaaggatataatgttaaacaaagaggagacgaagaaagaaaacagctttgaaatgcaaaaaggtgatcagaatcctcaaattgcggcacatgtcataagtgaggccagcagtaaaacaacatctgtgttacagtgggctgaaaaaggatactacaccatgagcaacaacttggtaaccctggaaaatgggaaacagctgaccgttaaaagacaaggactctattatatctatgcccaagtcaccttctgttccaatcgggaagcttcgagtcaagctccatttatagccagcctctgcctaaagtcccccggtagattcgagagaatcttactcagagctgcaaatacccacagttccgccaaaccttgcgggcaacaatccattcacttgggaggagtatttgaattgcaaccaggtgcttcggtgtttgtcaatgtgactgatccaagccaagtgagccatggcactggcttcacgtcctttggcttactcaaactctga
Sequence Length
786
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
959
Molecular Weight
29,274 Da
NCBI Official Full Name
Homo sapiens CD40 ligand, mRNA
NCBI Official Synonym Full Names
CD40 ligand
NCBI Official Symbol
CD40LG
NCBI Official Synonym Symbols
IGM; IMD3; TRAP; gp39; CD154; CD40L; HIGM1; T-BAM; TNFSF5; hCD40L
NCBI Protein Information
CD40 ligand
UniProt Protein Name
CD40 ligand
Protein Family
UniProt Gene Name
CD40LG
UniProt Synonym Gene Names
CD40L; TNFSF5; TRAP; CD40-L; TRAP
UniProt Entry Name
CD40L_HUMAN

NCBI Description

The protein encoded by this gene is expressed on the surface of T cells. It regulates B cell function by engaging CD40 on the B cell surface. A defect in this gene results in an inability to undergo immunoglobulin class switch and is associated with hyper-IgM syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

CD40LG: Mediates B-cell proliferation in the absence of co- stimulus as well as IgE production in the presence of IL-4. Involved in immunoglobulin class switching. Defects in CD40LG are the cause of X-linked immunodeficiency with hyper-IgM type 1 (HIGM1); also known as X-linked hyper IgM syndrome (XHIM). HIGM1 is an immunoglobulin isotype switch defect characterized by elevated concentrations of serum IgM and decreased amounts of all other isotypes. Affected males present at an early age (usually within the first year of life) recurrent bacterial and opportunistic infections, including Pneumocystis carinii pneumonia and intractable diarrhea due to cryptosporidium infection. Despite substitution treatment with intravenous immunoglobulin, the overall prognosis is rather poor, with a death rate of about 10% before adolescence. Belongs to the tumor necrosis factor family.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq26

Cellular Component: cell surface; integral to plasma membrane; plasma membrane

Molecular Function: CD40 receptor binding; protein binding

Biological Process: activation of JNK activity; activation of NF-kappaB transcription factor; B cell proliferation; inflammatory response; isotype switching; negative regulation of apoptosis; platelet activation; positive regulation of interleukin-10 production; positive regulation of interleukin-12 production; positive regulation of interleukin-4 production; positive regulation of T cell proliferation; regulation of immune response; T cell costimulation; tumor necrosis factor-mediated signaling pathway

Disease: Immunodeficiency With Hyper-igm, Type 1

Research Articles on CD40LG

Similar Products

Product Notes

The CD40LG cd40lg (Catalog #AAA1270827) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcgaaa catacaacca aacttctccc cgatctgcgg ccactggact gcccatcagc atgaaaattt ttatgtattt acttactgtt tttcttatca cccagatgat tgggtcagca ctttttgctg tgtatcttca tagaaggttg gacaagatag aagatgaaag gaatcttcat gaagattttg tattcatgaa aacgatacag agatgcaaca caggagaaag atccttatcc ttactgaact gtgaggagat taaaagccag tttgaaggct ttgtgaagga tataatgtta aacaaagagg agacgaagaa agaaaacagc tttgaaatgc aaaaaggtga tcagaatcct caaattgcgg cacatgtcat aagtgaggcc agcagtaaaa caacatctgt gttacagtgg gctgaaaaag gatactacac catgagcaac aacttggtaa ccctggaaaa tgggaaacag ctgaccgtta aaagacaagg actctattat atctatgccc aagtcacctt ctgttccaat cgggaagctt cgagtcaagc tccatttata gccagcctct gcctaaagtc ccccggtaga ttcgagagaa tcttactcag agctgcaaat acccacagtt ccgccaaacc ttgcgggcaa caatccattc acttgggagg agtatttgaa ttgcaaccag gtgcttcggt gtttgtcaat gtgactgatc caagccaagt gagccatggc actggcttca cgtcctttgg cttactcaaa ctctga. It is sometimes possible for the material contained within the vial of "CD40LG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.