TOR3A cdna clone
TOR3A cDNA Clone
Gene Names
TOR3A; ADIR; ADIR2
Synonyms
TOR3A; TOR3A cDNA Clone; TOR3A cdna clone
Sequence
atgcttcgcggtccgtggcgccagctttggctctttctcctgctgctgctcccgggcgcgcctgagccccgcggcgcctccaggccgtgggagggaaccgacgagccgggctcggcctgggcctggccgggcttccagcgcctgcaggagcagctcagggcggcgggtgccctctccaagcggtactggacgctcttcagctgccaggtgtggcccgacgactgtgacgaggacgaggaggcagccacggggcccctgggctggcgccttcctctgttgggccagcggtacctggacctcctgaccacgtggtactgcagcttcaaagactgctgccctagaggggattgcagaatctccaacaactttacaggcttagagtgggacctgaatgtgcggctgcatggccagcatttggtccagcagctggtcctaagaacagtgaggggctacttagagacgccccagccagaaaaggcccttgctctgtcgttccacggctggtctggcacaggcaagaacttcgtggcacggatgctggtggagaacctgtatcgggacgggctgatgagtgactgtgtcaggatgttcatcgccacgttccactttcctcaccccaaatatgtggacctgtacaaggagcagctgatgagccagatccgggagacgcagcagctctgccaccagaccctgttcatcttcgatgaagcggagaagctgcacccagggctgctggaggtccttgggccacacttagaacgccgggcccctgagggccacagggctgagtctccatggactatctttctgtttcccagtaatctcaggggcgatataatcaatgaggtggtcctaaagttgctcaaggctggatggtcccgggaagaaattacgatggaacacctggagccccacctccaggcggagattgtggagaccatagacaatggctttggccacagccgtcttgtgaaggaaaacctgattgactacttcatccccttcctgcctttggagtaccgtcacgtgaggctgtgtgcacgggatgccttcctgagccaggagctcctgtataaagaagagacactggatgaaatagcccagatgatggtgtatgtccccaaggaggaacaactcttttcttcccagggctgcaagtctatttcccagaggattaactacttcctgtcatga
Sequence Length
1194
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,180 Da
NCBI Official Full Name
Homo sapiens torsin family 3, member A, mRNA
NCBI Official Synonym Full Names
torsin family 3 member A
NCBI Official Symbol
TOR3A
NCBI Official Synonym Symbols
ADIR; ADIR2
NCBI Protein Information
torsin-3A
UniProt Protein Name
Torsin-3A
Protein Family
UniProt Gene Name
TOR3A
UniProt Synonym Gene Names
ADIR
UniProt Entry Name
TOR3A_HUMAN
Uniprot Description
TOR3A: Belongs to the clpA/clpB family. Torsin subfamily. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1q25.2
Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen
Molecular Function: ATPase activity
Research Articles on TOR3A
Similar Products
Product Notes
The TOR3A tor3a (Catalog #AAA1270807) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttcgcg gtccgtggcg ccagctttgg ctctttctcc tgctgctgct cccgggcgcg cctgagcccc gcggcgcctc caggccgtgg gagggaaccg acgagccggg ctcggcctgg gcctggccgg gcttccagcg cctgcaggag cagctcaggg cggcgggtgc cctctccaag cggtactgga cgctcttcag ctgccaggtg tggcccgacg actgtgacga ggacgaggag gcagccacgg ggcccctggg ctggcgcctt cctctgttgg gccagcggta cctggacctc ctgaccacgt ggtactgcag cttcaaagac tgctgcccta gaggggattg cagaatctcc aacaacttta caggcttaga gtgggacctg aatgtgcggc tgcatggcca gcatttggtc cagcagctgg tcctaagaac agtgaggggc tacttagaga cgccccagcc agaaaaggcc cttgctctgt cgttccacgg ctggtctggc acaggcaaga acttcgtggc acggatgctg gtggagaacc tgtatcggga cgggctgatg agtgactgtg tcaggatgtt catcgccacg ttccactttc ctcaccccaa atatgtggac ctgtacaagg agcagctgat gagccagatc cgggagacgc agcagctctg ccaccagacc ctgttcatct tcgatgaagc ggagaagctg cacccagggc tgctggaggt ccttgggcca cacttagaac gccgggcccc tgagggccac agggctgagt ctccatggac tatctttctg tttcccagta atctcagggg cgatataatc aatgaggtgg tcctaaagtt gctcaaggct ggatggtccc gggaagaaat tacgatggaa cacctggagc cccacctcca ggcggagatt gtggagacca tagacaatgg ctttggccac agccgtcttg tgaaggaaaa cctgattgac tacttcatcc ccttcctgcc tttggagtac cgtcacgtga ggctgtgtgc acgggatgcc ttcctgagcc aggagctcct gtataaagaa gagacactgg atgaaatagc ccagatgatg gtgtatgtcc ccaaggagga acaactcttt tcttcccagg gctgcaagtc tatttcccag aggattaact acttcctgtc atga. It is sometimes possible for the material contained within the vial of "TOR3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
