Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOT11 cdna clone

ACOT11 cDNA Clone

Synonyms
ACOT11; ACOT11 cDNA Clone; ACOT11 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagacggcgagggataccggaaccccacggaggtgcagatgagccagctggtgctgccctgccacaccaaccaacgtggtgagctgagcgtcgggcagctgctcaagtggattgacaccacggcttgcctgtccgcggagaggcacgctggctgcccctgtgtcacagcttccatggatgacatctattttgagcacaccattagtgttggacaagtggtgaatatcaaggccaaggtgaaccgggccttcaactccagcatggaggtgggcatccaggtggcctcggaggacctgtgctctgagaagcagtggaatgtgtgcaaggccttggccaccttcgtggcccgccgagagatcaccaaggtgaagctgaagcagatcacgccgcggacagaagaggagaagatggagcacagtgtggcggctgagcgccggcgcatgcgccttgtctatgcagacaccatcaaggacctcctggccaactgcgccattcagggcgatctggagagcagagactgtagccgcatggtgccggctgagaagacccgtgtggagagtgtggagctggtcctgcctccccacgccaatcaccagggcaacacctttgggggccagatcatggcctggatggagaatgtggccaccattgcagccaggtga
Sequence Length
666
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,152 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 11, mRNA
UniProt Protein Name
Acyl-coenzyme A thioesterase 11
UniProt Gene Name
ACOT11
UniProt Synonym Gene Names
BFIT; KIAA0707; THEA; Acyl-CoA thioesterase 11; BFIT
UniProt Entry Name
ACO11_HUMAN

Uniprot Description

ACOT11: Has acyl-CoA thioesterase activity towards medium (C12) and long-chain (C18) fatty acyl-CoA substrates. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.1.2.-

Chromosomal Location of Human Ortholog: 1p32.3

Cellular Component: cytoplasm; cytosol

Molecular Function: acyl-CoA hydrolase activity

Biological Process: acyl-CoA metabolic process; fatty acid metabolic process; response to cold; response to temperature stimulus

Similar Products

Product Notes

The ACOT11 acot11 (Catalog #AAA1270629) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagacg gcgagggata ccggaacccc acggaggtgc agatgagcca gctggtgctg ccctgccaca ccaaccaacg tggtgagctg agcgtcgggc agctgctcaa gtggattgac accacggctt gcctgtccgc ggagaggcac gctggctgcc cctgtgtcac agcttccatg gatgacatct attttgagca caccattagt gttggacaag tggtgaatat caaggccaag gtgaaccggg ccttcaactc cagcatggag gtgggcatcc aggtggcctc ggaggacctg tgctctgaga agcagtggaa tgtgtgcaag gccttggcca ccttcgtggc ccgccgagag atcaccaagg tgaagctgaa gcagatcacg ccgcggacag aagaggagaa gatggagcac agtgtggcgg ctgagcgccg gcgcatgcgc cttgtctatg cagacaccat caaggacctc ctggccaact gcgccattca gggcgatctg gagagcagag actgtagccg catggtgccg gctgagaaga cccgtgtgga gagtgtggag ctggtcctgc ctccccacgc caatcaccag ggcaacacct ttgggggcca gatcatggcc tggatggaga atgtggccac cattgcagcc aggtga. It is sometimes possible for the material contained within the vial of "ACOT11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.