Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOL6 cdna clone

APOL6 cDNA Clone

Gene Names
APOL6; APOLVI; APOL-VI
Synonyms
APOL6; APOL6 cDNA Clone; APOL6 cdna clone
Ordering
For Research Use Only!
Sequence
atggacaaccaggcggagagagaaagtgaggctggtgttggtttgcaaagggatgaggatgacgctcctctgtgtgaagacgtggagctacaagacggagatctgtcccccgaagaaaaaatatttttgagagaatttcccagattgaaagaagatctgaaagggaacattgacaagctccgtgccctcgcagacgatattgacaaaacccacaagaaattcaccaaggctaacatggtggccacctctactgctgtcatctctggagtgatgagcctcctgggtttagcccttgccccagcaacaggaggaggaagcctgctgctctccaccgctggtcaaggtttggcaacagcagctggggtcaccagcatcgtgagtggtacgttggaacgctccaaaaataaagaagcccaagcacgggcggaagacatactgcccacctacgaccaagaggacagggaggatgaggaagagaaggcagactatgtcacagctgctggaaagattatctataatcttagaaacaccttgaagtatgccaagaaaaacgtccgtgcattttggaaactcagagccaacccacgcttggccaatgctaccaagcgtcttctgaccactggccaagtctcctcccggagccgcgtgcaggtgcaaaaggcctttgcgggaacaacactggcgatgaccaaaaatgctcgcgtgctgggaggtgtgatgtccgccttctcccttggctatgacttggccactctctcaaaggaatggaagcacctgaaggaaggagcaaggacaaagtttgcggaagagttgagagccaaggccttggagctggagaggaaactcacagaactcacccagctctacaagagcttgcagcagaaagtgaggtcaagggccagaggggtggggaaggatttaactgggacctgcgaaaccgaggcttactggaaggagttaagggagcatgtgtggatgtggctgtggctgtgtgtgtgtctgtgtgtctgtgtgtatgtacagtttacatga
Sequence Length
1032
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,128 Da
NCBI Official Full Name
Homo sapiens apolipoprotein L, 6, mRNA
NCBI Official Synonym Full Names
apolipoprotein L6
NCBI Official Symbol
APOL6
NCBI Official Synonym Symbols
APOLVI; APOL-VI
NCBI Protein Information
apolipoprotein L6
UniProt Protein Name
Apolipoprotein L6
Protein Family
UniProt Gene Name
APOL6
UniProt Synonym Gene Names
ApoL-VI
UniProt Entry Name
APOL6_HUMAN

NCBI Description

This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]

Uniprot Description

APOL6: May affect the movement of lipids in the cytoplasm or allow the binding of lipids to organelles. Belongs to the apolipoprotein L family.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 22q12.3

Research Articles on APOL6

Similar Products

Product Notes

The APOL6 apol6 (Catalog #AAA1270628) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaacc aggcggagag agaaagtgag gctggtgttg gtttgcaaag ggatgaggat gacgctcctc tgtgtgaaga cgtggagcta caagacggag atctgtcccc cgaagaaaaa atatttttga gagaatttcc cagattgaaa gaagatctga aagggaacat tgacaagctc cgtgccctcg cagacgatat tgacaaaacc cacaagaaat tcaccaaggc taacatggtg gccacctcta ctgctgtcat ctctggagtg atgagcctcc tgggtttagc ccttgcccca gcaacaggag gaggaagcct gctgctctcc accgctggtc aaggtttggc aacagcagct ggggtcacca gcatcgtgag tggtacgttg gaacgctcca aaaataaaga agcccaagca cgggcggaag acatactgcc cacctacgac caagaggaca gggaggatga ggaagagaag gcagactatg tcacagctgc tggaaagatt atctataatc ttagaaacac cttgaagtat gccaagaaaa acgtccgtgc attttggaaa ctcagagcca acccacgctt ggccaatgct accaagcgtc ttctgaccac tggccaagtc tcctcccgga gccgcgtgca ggtgcaaaag gcctttgcgg gaacaacact ggcgatgacc aaaaatgctc gcgtgctggg aggtgtgatg tccgccttct cccttggcta tgacttggcc actctctcaa aggaatggaa gcacctgaag gaaggagcaa ggacaaagtt tgcggaagag ttgagagcca aggccttgga gctggagagg aaactcacag aactcaccca gctctacaag agcttgcagc agaaagtgag gtcaagggcc agaggggtgg ggaaggattt aactgggacc tgcgaaaccg aggcttactg gaaggagtta agggagcatg tgtggatgtg gctgtggctg tgtgtgtgtc tgtgtgtctg tgtgtatgta cagtttacat ga. It is sometimes possible for the material contained within the vial of "APOL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.