Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FZD9 cdna clone

FZD9 cDNA Clone

Gene Names
FZD9; FZD3; CD349
Synonyms
FZD9; FZD9 cDNA Clone; FZD9 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgtggcgcctctgcggggggcgctgctgctgtggcagctgctggcggcgggcggcgcggcactggagatcggccgcttcgacccggagcgcgggcgcggggctgcgccgtgccaggcggtggagatccccatgtgccgcggcatcggctacaacctgacccgcatgcccaacctgctgggccacacgtcgcagggcgaggcggctgccgagctagcggagttcgcgccgctggtgcagtacggctgccacagccacctgcgcttcttcctgtgctcgctctacgcgcccatgtgcaccgaccaggtctcgacgcccattcccgcctgccggcccatgtgcgagcaggcgcgcctgcgctgcgcgcccatcatggagcagttcaacttcggctggccggactcgctcgactgcgcccggctgcccacgcgcaacgacccgcacgcgctgtgcatggaggcgcccgagaacgccacggccggccccgcggagccccacaagggcctgggcatgctgcccgtggcgccgcggcccgcgcgccctcccggagacctgggcccgggcgcgggcggcagtggcacctgcgagaaccgcgagaagttccagtacgtggagaagagccgctcgtgcgcaccgcgctgcgggcccggcgtcgaggtgttctggtcccggcgcgacaaggacttcgcgctggtctggatggccgtgtggtcggcgctgtgcttcttctccaccgccttcactgtgctcaccttcttgctggagccccaccgcttccagtaccccgagcgccccatcatcttcctctccatgtgctacaacgtctactcgctggccttcctgatccgtgcggtggccggagcgcagagcgtggcctgtgaccaggaggcgggcgcgctctacgtgatccaggagggcctggagaacacgggctgcacgctggtcttcctactgctctactacttcggcatggccagctcgctctggtgggtggtcctgacgctcacctggttcctggctgccgggaagaaatggggccacgaggccatcgaggcccacggcagctatttccacatggctgcctggggcctgcccgcgctcaagaccatcgtcatcctgaccctgcgcaaggtggcgggtgatgagctgactgggctttgctacgtggccagcacggatgcagcagcgctcacgggcttcgtgctggtgcccctctctggctacctggtgctgggcagtagtttcctcctgaccggcttcgtggccctcttccacatccgcaagatcatgaagacgggcggcaccaacacagagaagctggagaagctcatggtcaaggtcggggtcttctccatcctctacacggtgcccgccacctgcgtcatcgtttgctatgtctacgaacgcctcaacatggacttctggcgccttcgggccacagagcagccatgcgcagcggccgcggggcccggaggccggagggactgctcgctgccagggggctcggtgcccaccgtggcggtcttcatgctcaaaattttcatgtcactggtggtggggatcaccaacggcgtctgggtgtggagctccaagactttccagacctggcagagcctgtgctaccgcaagatagcagctggccgggcccgggccaaggcctgccacgcccccgggagctacggacgtggcacgcactgccactataaggctcccaccgtggtcttgcacatgactaagacggacccctctttggagaaccccacacacctctag
Sequence Length
1776
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,466 Da
NCBI Official Full Name
Homo sapiens frizzled homolog 9 (Drosophila), mRNA
NCBI Official Synonym Full Names
frizzled class receptor 9
NCBI Official Symbol
FZD9
NCBI Official Synonym Symbols
FZD3; CD349
NCBI Protein Information
frizzled-9
UniProt Protein Name
Frizzled-9
Protein Family
UniProt Gene Name
FZD9
UniProt Synonym Gene Names
FZD3; Fz-9; hFz9
UniProt Entry Name
FZD9_HUMAN

NCBI Description

Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]

Uniprot Description

FZD9: Receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK- 3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Belongs to the G-protein coupled receptor Fz/Smo family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR; GPCR, Fz/Smo family

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: cell surface; cytoplasm; plasma membrane

Molecular Function: G-protein coupled receptor activity; protein heterodimerization activity; protein homodimerization activity; Wnt-protein binding

Biological Process: nervous system development; Wnt receptor signaling pathway through beta-catenin

Research Articles on FZD9

Similar Products

Product Notes

The FZD9 fzd9 (Catalog #AAA1270552) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgtgg cgcctctgcg gggggcgctg ctgctgtggc agctgctggc ggcgggcggc gcggcactgg agatcggccg cttcgacccg gagcgcgggc gcggggctgc gccgtgccag gcggtggaga tccccatgtg ccgcggcatc ggctacaacc tgacccgcat gcccaacctg ctgggccaca cgtcgcaggg cgaggcggct gccgagctag cggagttcgc gccgctggtg cagtacggct gccacagcca cctgcgcttc ttcctgtgct cgctctacgc gcccatgtgc accgaccagg tctcgacgcc cattcccgcc tgccggccca tgtgcgagca ggcgcgcctg cgctgcgcgc ccatcatgga gcagttcaac ttcggctggc cggactcgct cgactgcgcc cggctgccca cgcgcaacga cccgcacgcg ctgtgcatgg aggcgcccga gaacgccacg gccggccccg cggagcccca caagggcctg ggcatgctgc ccgtggcgcc gcggcccgcg cgccctcccg gagacctggg cccgggcgcg ggcggcagtg gcacctgcga gaaccgcgag aagttccagt acgtggagaa gagccgctcg tgcgcaccgc gctgcgggcc cggcgtcgag gtgttctggt cccggcgcga caaggacttc gcgctggtct ggatggccgt gtggtcggcg ctgtgcttct tctccaccgc cttcactgtg ctcaccttct tgctggagcc ccaccgcttc cagtaccccg agcgccccat catcttcctc tccatgtgct acaacgtcta ctcgctggcc ttcctgatcc gtgcggtggc cggagcgcag agcgtggcct gtgaccagga ggcgggcgcg ctctacgtga tccaggaggg cctggagaac acgggctgca cgctggtctt cctactgctc tactacttcg gcatggccag ctcgctctgg tgggtggtcc tgacgctcac ctggttcctg gctgccggga agaaatgggg ccacgaggcc atcgaggccc acggcagcta tttccacatg gctgcctggg gcctgcccgc gctcaagacc atcgtcatcc tgaccctgcg caaggtggcg ggtgatgagc tgactgggct ttgctacgtg gccagcacgg atgcagcagc gctcacgggc ttcgtgctgg tgcccctctc tggctacctg gtgctgggca gtagtttcct cctgaccggc ttcgtggccc tcttccacat ccgcaagatc atgaagacgg gcggcaccaa cacagagaag ctggagaagc tcatggtcaa ggtcggggtc ttctccatcc tctacacggt gcccgccacc tgcgtcatcg tttgctatgt ctacgaacgc ctcaacatgg acttctggcg ccttcgggcc acagagcagc catgcgcagc ggccgcgggg cccggaggcc ggagggactg ctcgctgcca gggggctcgg tgcccaccgt ggcggtcttc atgctcaaaa ttttcatgtc actggtggtg gggatcacca acggcgtctg ggtgtggagc tccaagactt tccagacctg gcagagcctg tgctaccgca agatagcagc tggccgggcc cgggccaagg cctgccacgc ccccgggagc tacggacgtg gcacgcactg ccactataag gctcccaccg tggtcttgca catgactaag acggacccct ctttggagaa ccccacacac ctctag. It is sometimes possible for the material contained within the vial of "FZD9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.