Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NOSIP cdna clone

NOSIP cDNA Clone

Gene Names
NOSIP; CGI-25
Synonyms
NOSIP; NOSIP cDNA Clone; NOSIP cdna clone
Ordering
For Research Use Only!
Sequence
atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcaccccagatggctacctgtatgagcgtgaggccatcctggagtacattctgcaccagaagaaggagattgcccggcagatgaaggcctacgagaagcagcggggcacccggcgcgaggagcagaaggagcttcagcgggcggcctcgcaggaccatgtgcggggcttcctggagaaggagtcggctatcgtgagccggcccctcaaccctttcacagccaaggccctctcgggcaccagcccagatgatgtccaacctgggcccagtgtgggtcctccaagtaaggacaaggacaaagtgctgcccagcttctggatcccgtcgctgatgcccgaagccaaggccaccaagctggagaagccgtcccgcacggtgacctgccccatgtcagggaagcccctgcgcatgtcggacctgacgcccgtgcacttcacaccgctagacagctccgtggaccgcgtggggctcatcacccgcagcgagcgctacgtgtgtgccgtgacccgcgacagcctgagcaacgccaccccctgcgctgtgctgcggccctctggggctgtggtcaccctcgaatgcgtggagaagctgattcggaaggacatggtggaccctgtgactggagacaaactcacagaccgcgacatcatcgtgctgcagcggggcggtaccggcttcgcgggctccggagtgaagctgcaagcggagaaatcacggccggtgatgcaggcctga
Sequence Length
906
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,172 Da
NCBI Official Full Name
Homo sapiens nitric oxide synthase interacting protein, mRNA
NCBI Official Synonym Full Names
nitric oxide synthase interacting protein
NCBI Official Symbol
NOSIP
NCBI Official Synonym Symbols
CGI-25
NCBI Protein Information
nitric oxide synthase-interacting protein
UniProt Protein Name
Nitric oxide synthase-interacting protein
UniProt Gene Name
NOSIP
UniProt Entry Name
NOSIP_HUMAN

NCBI Description

The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2012]

Uniprot Description

NOSIP: Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity. Belongs to the NOSIP family.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: cytoplasm; cytosol; Golgi membrane; nucleus

Molecular Function: protein binding

Biological Process: negative regulation of catalytic activity; negative regulation of nitric-oxide synthase activity; regulation of nitric-oxide synthase activity

Research Articles on NOSIP

Similar Products

Product Notes

The NOSIP nosip (Catalog #AAA1270514) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgcggc atggcaagaa ctgcaccgca ggggccgtct acacctacca cgagaagaag aaggacacag cggcctcggg ctatgggacc cagaacattc gactgagccg ggatgccgtg aaggacttcg actgctgttg tctctccctg cagccttgcc acgatcctgt tgtcacccca gatggctacc tgtatgagcg tgaggccatc ctggagtaca ttctgcacca gaagaaggag attgcccggc agatgaaggc ctacgagaag cagcggggca cccggcgcga ggagcagaag gagcttcagc gggcggcctc gcaggaccat gtgcggggct tcctggagaa ggagtcggct atcgtgagcc ggcccctcaa ccctttcaca gccaaggccc tctcgggcac cagcccagat gatgtccaac ctgggcccag tgtgggtcct ccaagtaagg acaaggacaa agtgctgccc agcttctgga tcccgtcgct gatgcccgaa gccaaggcca ccaagctgga gaagccgtcc cgcacggtga cctgccccat gtcagggaag cccctgcgca tgtcggacct gacgcccgtg cacttcacac cgctagacag ctccgtggac cgcgtggggc tcatcacccg cagcgagcgc tacgtgtgtg ccgtgacccg cgacagcctg agcaacgcca ccccctgcgc tgtgctgcgg ccctctgggg ctgtggtcac cctcgaatgc gtggagaagc tgattcggaa ggacatggtg gaccctgtga ctggagacaa actcacagac cgcgacatca tcgtgctgca gcggggcggt accggcttcg cgggctccgg agtgaagctg caagcggaga aatcacggcc ggtgatgcag gcctga. It is sometimes possible for the material contained within the vial of "NOSIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.