KLHL14 cdna clone
KLHL14 cDNA Clone
Synonyms
KLHL14; KLHL14 cDNA Clone; KLHL14 cdna clone
Sequence
atgtccagatccggggacaggacctccaccttcgaccccagccacagcgacaacctgctgcacggcctcaacctgctgtggaggaagcagctgttttgcgacgtgaccctgacggcccagggccagcagttccattgccacaaggccgtgctggcctcctgctcgcagtacttccgatcgctcttctccagccacccccctctcgggggaggggtcggcggccaggacggcctgggggcccccaaggaccagcagcagccgccgcagcagcagccgtcacagcagcagcagccgccgccgcaggaggagcccgggactccttcttcctcccccgacgacaagctgctgaccagcccccgggccatcaacaacctggtgctgcagggctgctcgtccatcgggctgcgcctggtgctcgagtacctctacacggccaacgtgaccctgtccctggacacggtggaggaggtgctgtcggtcagcaagatcctgcacatcccccaggtcaccaagctctgcgtgcagttcctcaacgaccagatctcggtgcagaactacaagcaggtgtgcaagatcgccgcgctgcacggcctggaggagaccaagaagctggccaacaagtacctggtggaggatgtgctgctgctcaacttcgaggagatgcgcgccctgctggactcgctgccgccccccgtggagtcggagctggcgctcttccagatgtccgtgctgtggctggagcacgaccgcgagacccgcatgcagtatgcgcctgacctcatgaagcgcctccgcttcgccctcatcccggccccggagctggtggagcgggtccagtcagtggatttcatgcgaaccgacccagtctgccagaagctgctgctggacgccatgaactaccacctgatgcccttcaggcagcactgcaggcagagcctggccagcagaattcgctctaacaagaaaatgctgttattggttggagggctgcctcctggaccggaccggctccccagcaatttggttcagtattacgacgatgaaaagaagacatggaaaatactcacaatcacaggaccacaccccatttcagggaagcaggaaagtgcaagctcaccagagttcagaaggaggaaaaccagagaattttcaaacaacacaatgtga
Sequence Length
1167
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,792 Da
NCBI Official Full Name
Homo sapiens kelch-like 14 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 14
NCBI Official Symbol
KLHL14
NCBI Protein Information
kelch-like protein 14
UniProt Protein Name
Kelch-like protein 14
Protein Family
UniProt Gene Name
KLHL14
UniProt Synonym Gene Names
KIAA1384; Printor; Protein interactor of torsinA
UniProt Entry Name
KLH14_HUMAN
NCBI Description
The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Uniprot Description
KLHL14: 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 18q12.1
Cellular Component: cell soma; endoplasmic reticulum; neuron projection
Molecular Function: ubiquitin-protein ligase activity
Research Articles on KLHL14
Similar Products
Product Notes
The KLHL14 klhl14 (Catalog #AAA1270510) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccagat ccggggacag gacctccacc ttcgacccca gccacagcga caacctgctg cacggcctca acctgctgtg gaggaagcag ctgttttgcg acgtgaccct gacggcccag ggccagcagt tccattgcca caaggccgtg ctggcctcct gctcgcagta cttccgatcg ctcttctcca gccacccccc tctcggggga ggggtcggcg gccaggacgg cctgggggcc cccaaggacc agcagcagcc gccgcagcag cagccgtcac agcagcagca gccgccgccg caggaggagc ccgggactcc ttcttcctcc cccgacgaca agctgctgac cagcccccgg gccatcaaca acctggtgct gcagggctgc tcgtccatcg ggctgcgcct ggtgctcgag tacctctaca cggccaacgt gaccctgtcc ctggacacgg tggaggaggt gctgtcggtc agcaagatcc tgcacatccc ccaggtcacc aagctctgcg tgcagttcct caacgaccag atctcggtgc agaactacaa gcaggtgtgc aagatcgccg cgctgcacgg cctggaggag accaagaagc tggccaacaa gtacctggtg gaggatgtgc tgctgctcaa cttcgaggag atgcgcgccc tgctggactc gctgccgccc cccgtggagt cggagctggc gctcttccag atgtccgtgc tgtggctgga gcacgaccgc gagacccgca tgcagtatgc gcctgacctc atgaagcgcc tccgcttcgc cctcatcccg gccccggagc tggtggagcg ggtccagtca gtggatttca tgcgaaccga cccagtctgc cagaagctgc tgctggacgc catgaactac cacctgatgc ccttcaggca gcactgcagg cagagcctgg ccagcagaat tcgctctaac aagaaaatgc tgttattggt tggagggctg cctcctggac cggaccggct ccccagcaat ttggttcagt attacgacga tgaaaagaag acatggaaaa tactcacaat cacaggacca caccccattt cagggaagca ggaaagtgca agctcaccag agttcagaag gaggaaaacc agagaatttt caaacaacac aatgtga. It is sometimes possible for the material contained within the vial of "KLHL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
