Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP9B cdna clone

ATP9B cDNA Clone

Gene Names
ATP9B; NEO1L; hMMR1; ATPIIB; ATPASEP; HUSSY-20
Synonyms
ATP9B; ATP9B cDNA Clone; ATP9B cdna clone
Ordering
For Research Use Only!
Sequence
atgccactaatgatgtctgaagaaggctttgagaatgaggaaagtgattaccacaccttaccacgagccaggataatgcaaaggaaaagaggactggagtggtttgtctgtgatggctggaagttcctctgtaccagttgctgtggttggctgataaatatttgtcgaagaaagaaagagctgaaagctcgcacagtatggcttggatgtcctgaaaagtgtgaagaaaaacatcccaggaattctataaaaaatcaaaaatacaatgtgtttacctttatacctggggttttgtatgaacaattcaagtttttcttgaatctctattttctagtaatatcctgctcacagtttgtaccagcattgaaaataggctatctctacacctactgggctcctctgatgacatga
Sequence Length
411
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
128,198 Da
NCBI Official Full Name
Homo sapiens ATPase, class II, type 9B, mRNA
NCBI Official Synonym Full Names
ATPase phospholipid transporting 9B (putative)
NCBI Official Symbol
ATP9B
NCBI Official Synonym Symbols
NEO1L; hMMR1; ATPIIB; ATPASEP; HUSSY-20
NCBI Protein Information
probable phospholipid-transporting ATPase IIB
UniProt Protein Name
Probable phospholipid-transporting ATPase IIB
UniProt Gene Name
ATP9B
UniProt Synonym Gene Names
ATPIIB; NEO1L
UniProt Entry Name
ATP9B_HUMAN

Uniprot Description

ATP9B: Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; Membrane protein, multi-pass; EC 3.6.3.1; Membrane protein, integral; Transporter; Transporter, ion channel

Chromosomal Location of Human Ortholog: 18q23

Cellular Component: endosome; perinuclear region of cytoplasm; plasma membrane; trans-Golgi network

Molecular Function: phospholipid-translocating ATPase activity

Biological Process: endocytosis; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on ATP9B

Similar Products

Product Notes

The ATP9B atp9b (Catalog #AAA1270490) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactaa tgatgtctga agaaggcttt gagaatgagg aaagtgatta ccacacctta ccacgagcca ggataatgca aaggaaaaga ggactggagt ggtttgtctg tgatggctgg aagttcctct gtaccagttg ctgtggttgg ctgataaata tttgtcgaag aaagaaagag ctgaaagctc gcacagtatg gcttggatgt cctgaaaagt gtgaagaaaa acatcccagg aattctataa aaaatcaaaa atacaatgtg tttaccttta tacctggggt tttgtatgaa caattcaagt ttttcttgaa tctctatttt ctagtaatat cctgctcaca gtttgtacca gcattgaaaa taggctatct ctacacctac tgggctcctc tgatgacatg a. It is sometimes possible for the material contained within the vial of "ATP9B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.