Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM173 cdna clone

TMEM173 cDNA Clone

Gene Names
TMEM173; ERIS; MITA; MPYS; SAVI; NET23; STING; hMITA; hSTING
Synonyms
TMEM173; TMEM173 cDNA Clone; TMEM173 cdna clone
Ordering
For Research Use Only!
Sequence
atgccccactccagcctgcatccatccatcccgtgtcccaggggtcacggggcccagaaggcagccttggttctgctgagtgcctgcctggtgaccctttgggggctaggagagccaccagagcacactctccggtacctggtgctccacctagcctccctgcagctgggactgctgttaaacggggtctgcagcctggctgaggagctgcgccacatccactccaggtaccggggcagctactggaggactgtgcgggcctgcctgggctgccccctccgccgtggggccctgttgctgctgtccatctatttctactactccctcccaaatgcggtcggcccgcccttcacttggatgcttgccctcctgggcctctcgcaggcactgaacatcctcctgggcctcaagggcctggccccagctgagatctctgcagtgtgtgaaaaagggaatttcaacgtggcccatgggctggcatggtcatattacatcggatatctgcggctgatcctgccagagctccaggcccggattcgaacttacaatcagcattacaacaacctgctacggggtgcagtgagccagcggctgtatattctcctcccattggactgtggggtgcctgataacctgagtatggctgaccccaacattcgcttcctggataaactgccccagcagaccggtgaccatgctggcatcaaggatcgggtttacagcaacagcatctatgagcttctggagaacgggcagcgggcgggcacctgtgtcctggagtacgccacccccttgcagactttgtttgccatgtcacaatacagtcaagctggctttagccgggaggataggcttgagcaggccaaactcttctgccggacacttgaggacatcctggcagatgcccctgagtctcagaacaactgccgcctcattgcctaccaggaacctgcagatgacagcagcttctcgctgtcccaggaggttctccggcacctgcggcaggaggaaaaggaagaggttactgtgggcagcttgaagacctcagcggtgcccagtacctccacgatgtcccaagagcctgagctcctcatcagtggaatggaaaagcccctccctctccgcacggatttctcttga
Sequence Length
1140
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,193 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 173, mRNA
NCBI Official Synonym Full Names
transmembrane protein 173
NCBI Official Symbol
TMEM173
NCBI Official Synonym Symbols
ERIS; MITA; MPYS; SAVI; NET23; STING; hMITA; hSTING
NCBI Protein Information
stimulator of interferon genes protein
UniProt Protein Name
Stimulator of interferon genes protein
UniProt Gene Name
TMEM173
UniProt Synonym Gene Names
ERIS; MITA; STING; hSTING; ERIS; hMITA
UniProt Entry Name
STING_HUMAN

NCBI Description

This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Uniprot Description

TMEM173: Facilitator of innate immune signaling that promotes the production of type I interferon (IFN-alpha and IFN-beta). Innate immune response is triggered in response to non-CpG double- stranded DNA from viruses and bacteria delivered to the cytoplasm. Able to activate both NF-kappa-B and IRF3 transcription pathways to induce expression of type I interferon and exert a potent anti- viral state following expression. May be involved in translocon function, the translocon possibly being able to influence the induction of type I interferons. May be involved in transduction of apoptotic signals via its association with the major histocompatibility complex class II (MHC-II). Mediates death signaling via activation of the extracellular signal-regulated kinase (ERK) pathway. Associates with the MHC-II complex. Homodimer; 'Lys-63'-linked ubiquitination at Lys-150 is required for homodimerization. Interacts with DDX58/RIG-I, MAVS/VISA and SSR2. Interacts with RNF5 and TRIM56. Interacts with TBK1; when homodimer, leading to subsequent production of IFN-beta. Ubiquitously expressed. Belongs to the TMEM173 family.

Protein type: Membrane protein, multi-pass; Mitochondrial; Endoplasmic reticulum; Apoptosis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q31.2

Cellular Component: cytoplasmic vesicle membrane; endoplasmic reticulum membrane; mitochondrial outer membrane; perinuclear region of cytoplasm

Molecular Function: identical protein binding; protein binding; protein homodimerization activity; protein kinase binding; transcription factor binding

Biological Process: activation of innate immune response; defense response to virus; innate immune response; interferon-beta production; positive regulation of defense response to virus by host; positive regulation of interferon type I production; positive regulation of protein binding; positive regulation of protein import into nucleus, translocation; positive regulation of transcription factor import into nucleus; positive regulation of transcription from RNA polymerase II promoter; regulation of interferon type I production

Disease: Sting-associated Vasculopathy, Infantile-onset

Research Articles on TMEM173

Similar Products

Product Notes

The TMEM173 tmem173 (Catalog #AAA1270460) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccact ccagcctgca tccatccatc ccgtgtccca ggggtcacgg ggcccagaag gcagccttgg ttctgctgag tgcctgcctg gtgacccttt gggggctagg agagccacca gagcacactc tccggtacct ggtgctccac ctagcctccc tgcagctggg actgctgtta aacggggtct gcagcctggc tgaggagctg cgccacatcc actccaggta ccggggcagc tactggagga ctgtgcgggc ctgcctgggc tgccccctcc gccgtggggc cctgttgctg ctgtccatct atttctacta ctccctccca aatgcggtcg gcccgccctt cacttggatg cttgccctcc tgggcctctc gcaggcactg aacatcctcc tgggcctcaa gggcctggcc ccagctgaga tctctgcagt gtgtgaaaaa gggaatttca acgtggccca tgggctggca tggtcatatt acatcggata tctgcggctg atcctgccag agctccaggc ccggattcga acttacaatc agcattacaa caacctgcta cggggtgcag tgagccagcg gctgtatatt ctcctcccat tggactgtgg ggtgcctgat aacctgagta tggctgaccc caacattcgc ttcctggata aactgcccca gcagaccggt gaccatgctg gcatcaagga tcgggtttac agcaacagca tctatgagct tctggagaac gggcagcggg cgggcacctg tgtcctggag tacgccaccc ccttgcagac tttgtttgcc atgtcacaat acagtcaagc tggctttagc cgggaggata ggcttgagca ggccaaactc ttctgccgga cacttgagga catcctggca gatgcccctg agtctcagaa caactgccgc ctcattgcct accaggaacc tgcagatgac agcagcttct cgctgtccca ggaggttctc cggcacctgc ggcaggagga aaaggaagag gttactgtgg gcagcttgaa gacctcagcg gtgcccagta cctccacgat gtcccaagag cctgagctcc tcatcagtgg aatggaaaag cccctccctc tccgcacgga tttctcttga. It is sometimes possible for the material contained within the vial of "TMEM173, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.