KLHL26 cdna clone
KLHL26 cDNA Clone
Synonyms
KLHL26; KLHL26 cDNA Clone; KLHL26 cdna clone
Sequence
atggcggagtccggcggtagcagcggtggtgctggtggcggcggcgctttcggcgcgggcccgggccccgagcgcccgaacagcacggccgacaagaacggggccctcaagtgcaccttctcggcacccagccacagcaccagcctcctgcagggcctggccaccctccgcgctcagggccagctcctcgatgttgtgctgactattaacagagaggcctttcctgcacacaaggtcgtcctggctgcctgcagcgactacttcagggccatgttcaccggcggcatgcgggaggcaagccaggacgtcatcgagctgaagggcgtgtcggcccgtggcctgcggcacatcatcgacttcgcctacagcgccgaggtgacactggacctggactgcgtgcaggacgtgctgggcgcggccgtgttcttgcagatgctgcccgtggtggagctgtgcgaggagttcctgaaggcggccatgagcgtggagacctgcctcaacatcggccagatggccaccaccttcagcctggcctcgctgcgagagtcggtggatgccttcaccttccggcacttcctgcagatcgccgaggaggaggatttcctgcgcctgccactggagcgcctggtcttcttcctgcagagcaaccggctgcagagctgtgccgagatcgacctgttccgcgcggccgtccgctggctgcagcatgacccggcccggcggccgcgcgccagccacgtgctctgccacattcgcttcccgctcatgcagtcgtccgagctggtggacagcgtgcagacgctggacatcatggtggaggacgtgctgtgccgccagtatctgctggaggccttcaactaccaggtgctgcccttccggcagcacgagatgcagtctccgcgcactgccgtgcgctcggatgtgccctcgctcgtcaccttcggcggcacgccctacaccgacagcgaccgctcggtcagcagcaaggtctaccagctgcctgagccgggagcccgccacttccgcgagctcacggagatggaggtaggctgcagccacacgtgcgtggccgtgctggacaattttgtgtacgtggccggggggcagcacctgcagtaccgcagcggcgagggcgcagtggacgcctgctaccgctacgacccccacctgaatcgctggctgcgcctgcaggccatgcaggaaagccgcatccagttccagctgaacgtgctgtgcggcatggtgtacgccacgggcggccgcaaccgagccggcagcctggcctccgtggagcggtactgcccccggcgcaatgagtggggctacgcctgctcgctgaagcgccgtacctggggccatgctggggccgcctcagggggccgcctctacatctcgggtggctacgggatctcagtggaggacaagaaggccctgcactgctacgaccccgtggccgaccagtgggagttcaaggcgcccatgagcgaaccccgcgtgctacacgccatggtgggtgccggcggccgcatctatgccctcgggggccgcatggaccacgtggaccgctgcttcgacgtgctggctgtggagtactatgtgccggagacggaccagtggaccagcatgagccccatgcgggccggccagtcagaggccggctgctgcctgctggagaggaagatctacatcgtcgggggctacaactggcgtctcaacaacgtcacgggcatcgtacaggtgtacaacacggacaccgacgagtgggagcgggacctgcacttcccggagtccttcgcaggcatagcctgcgcccccgtcctgctgccccgggccgggaccaggaggtag
Sequence Length
1848
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,139 Da
NCBI Official Full Name
Homo sapiens kelch-like 26 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 26
NCBI Official Symbol
KLHL26
NCBI Protein Information
kelch-like protein 26
UniProt Protein Name
Kelch-like protein 26
Protein Family
UniProt Gene Name
KLHL26
UniProt Entry Name
KLH26_HUMAN
Uniprot Description
KLHL26:
Chromosomal Location of Human Ortholog: 19p13.11
Molecular Function: ubiquitin-protein ligase activity
Similar Products
Product Notes
The KLHL26 klhl26 (Catalog #AAA1270448) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagt ccggcggtag cagcggtggt gctggtggcg gcggcgcttt cggcgcgggc ccgggccccg agcgcccgaa cagcacggcc gacaagaacg gggccctcaa gtgcaccttc tcggcaccca gccacagcac cagcctcctg cagggcctgg ccaccctccg cgctcagggc cagctcctcg atgttgtgct gactattaac agagaggcct ttcctgcaca caaggtcgtc ctggctgcct gcagcgacta cttcagggcc atgttcaccg gcggcatgcg ggaggcaagc caggacgtca tcgagctgaa gggcgtgtcg gcccgtggcc tgcggcacat catcgacttc gcctacagcg ccgaggtgac actggacctg gactgcgtgc aggacgtgct gggcgcggcc gtgttcttgc agatgctgcc cgtggtggag ctgtgcgagg agttcctgaa ggcggccatg agcgtggaga cctgcctcaa catcggccag atggccacca ccttcagcct ggcctcgctg cgagagtcgg tggatgcctt caccttccgg cacttcctgc agatcgccga ggaggaggat ttcctgcgcc tgccactgga gcgcctggtc ttcttcctgc agagcaaccg gctgcagagc tgtgccgaga tcgacctgtt ccgcgcggcc gtccgctggc tgcagcatga cccggcccgg cggccgcgcg ccagccacgt gctctgccac attcgcttcc cgctcatgca gtcgtccgag ctggtggaca gcgtgcagac gctggacatc atggtggagg acgtgctgtg ccgccagtat ctgctggagg ccttcaacta ccaggtgctg cccttccggc agcacgagat gcagtctccg cgcactgccg tgcgctcgga tgtgccctcg ctcgtcacct tcggcggcac gccctacacc gacagcgacc gctcggtcag cagcaaggtc taccagctgc ctgagccggg agcccgccac ttccgcgagc tcacggagat ggaggtaggc tgcagccaca cgtgcgtggc cgtgctggac aattttgtgt acgtggccgg ggggcagcac ctgcagtacc gcagcggcga gggcgcagtg gacgcctgct accgctacga cccccacctg aatcgctggc tgcgcctgca ggccatgcag gaaagccgca tccagttcca gctgaacgtg ctgtgcggca tggtgtacgc cacgggcggc cgcaaccgag ccggcagcct ggcctccgtg gagcggtact gcccccggcg caatgagtgg ggctacgcct gctcgctgaa gcgccgtacc tggggccatg ctggggccgc ctcagggggc cgcctctaca tctcgggtgg ctacgggatc tcagtggagg acaagaaggc cctgcactgc tacgaccccg tggccgacca gtgggagttc aaggcgccca tgagcgaacc ccgcgtgcta cacgccatgg tgggtgccgg cggccgcatc tatgccctcg ggggccgcat ggaccacgtg gaccgctgct tcgacgtgct ggctgtggag tactatgtgc cggagacgga ccagtggacc agcatgagcc ccatgcgggc cggccagtca gaggccggct gctgcctgct ggagaggaag atctacatcg tcgggggcta caactggcgt ctcaacaacg tcacgggcat cgtacaggtg tacaacacgg acaccgacga gtgggagcgg gacctgcact tcccggagtc cttcgcaggc atagcctgcg cccccgtcct gctgccccgg gccgggacca ggaggtag. It is sometimes possible for the material contained within the vial of "KLHL26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
