Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NDUFAF1 cdna clone

NDUFAF1 cDNA Clone

Gene Names
NDUFAF1; CGI65; CIA30; CGI-65
Synonyms
NDUFAF1; NDUFAF1 cDNA Clone; NDUFAF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctttggttcacaaattgctgcgtggtacttattttctcagaaaattctctaagccaacttctgccttgtatccatttttgggtattcgctttgcagagtattccagtagtcttcagaaaccagtggcttctcctggcaaagcctcctcacagaggaagactgaaggggatttgcaaggagatcaccagaaagaagttgctttggatataacttcttctgaggagaagcctgatgttagtttcgataaagcaattagagatgaagcaatataccattttaggcttttgaaggatgaaattgtggatcattggagaggaccggaaggccaccctctgcatgaggtcttgctggaacaagccaaggttgtctggcaattccgggggaaagaagatttggataagtggacagtgacttctgataagacgattggaggcagaagtgaagtgtttttgaaaatgggcaagaataaccaaagtgcactgctatatggaactctgagctctgaggcgcctcaggacggggagtctacccgaagtgggtactgtgcaatgatatccaggattccaaggggtgcttttgagaggaagatgtcttacgattggtcccagttcaatactctgtatctccgtgtacgtggggatggtcggccttggatggtgaatatcaaggaggacacagatttcttccagaggacgaatcagatgtatagttacttcatgttcacccgcgggggaccctactggcaggaggtcaagattcctttttccaaatttttcttctctaatcgaggaagaatccgggatgttcagcatgagcttccgcttgataagatctcttctataggattcaccttggctgataaagtggatggtccattcttcctggagatagattttattggcgtgtttactgatccagctcatacagaagaatttgcctatgaaaattctccagagcttaacccaaggctttttaaataa
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,764 Da
NCBI Official Full Name
Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1, mRNA
NCBI Official Synonym Full Names
NADH:ubiquinone oxidoreductase complex assembly factor 1
NCBI Official Symbol
NDUFAF1
NCBI Official Synonym Symbols
CGI65; CIA30; CGI-65
NCBI Protein Information
complex I intermediate-associated protein 30, mitochondrial
UniProt Protein Name
Complex I intermediate-associated protein 30, mitochondrial
UniProt Gene Name
NDUFAF1
UniProt Synonym Gene Names
CIA30
UniProt Entry Name
CIA30_HUMAN

NCBI Description

This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]

Uniprot Description

NDUFAF1: Chaperone protein involved in the assembly of the mitochondrial NADH:ubiquinone oxidoreductase complex (complex I). Belongs to the CIA30 family.

Chromosomal Location of Human Ortholog: 15q11.2-q21.3

Cellular Component: cytoplasm; mitochondrial inner membrane

Molecular Function: protein binding

Biological Process: mitochondrial respiratory chain complex I assembly

Disease: Mitochondrial Complex I Deficiency

Research Articles on NDUFAF1

Similar Products

Product Notes

The NDUFAF1 ndufaf1 (Catalog #AAA1270439) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttgg ttcacaaatt gctgcgtggt acttattttc tcagaaaatt ctctaagcca acttctgcct tgtatccatt tttgggtatt cgctttgcag agtattccag tagtcttcag aaaccagtgg cttctcctgg caaagcctcc tcacagagga agactgaagg ggatttgcaa ggagatcacc agaaagaagt tgctttggat ataacttctt ctgaggagaa gcctgatgtt agtttcgata aagcaattag agatgaagca atataccatt ttaggctttt gaaggatgaa attgtggatc attggagagg accggaaggc caccctctgc atgaggtctt gctggaacaa gccaaggttg tctggcaatt ccgggggaaa gaagatttgg ataagtggac agtgacttct gataagacga ttggaggcag aagtgaagtg tttttgaaaa tgggcaagaa taaccaaagt gcactgctat atggaactct gagctctgag gcgcctcagg acggggagtc tacccgaagt gggtactgtg caatgatatc caggattcca aggggtgctt ttgagaggaa gatgtcttac gattggtccc agttcaatac tctgtatctc cgtgtacgtg gggatggtcg gccttggatg gtgaatatca aggaggacac agatttcttc cagaggacga atcagatgta tagttacttc atgttcaccc gcgggggacc ctactggcag gaggtcaaga ttcctttttc caaatttttc ttctctaatc gaggaagaat ccgggatgtt cagcatgagc ttccgcttga taagatctct tctataggat tcaccttggc tgataaagtg gatggtccat tcttcctgga gatagatttt attggcgtgt ttactgatcc agctcataca gaagaatttg cctatgaaaa ttctccagag cttaacccaa ggctttttaa ataa. It is sometimes possible for the material contained within the vial of "NDUFAF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.