RAB3D cdna clone
RAB3D cDNA Clone
Gene Names
RAB3D; GOV; D2-2; RAB16; RAD3D
Synonyms
RAB3D; RAB3D cDNA Clone; RAB3D cdna clone
Sequence
atggcatcagctggagacacccaggcaggcccacgggatgcagcagatcagaacttcgactatatgttcaaactgctactgataggcaacagcagtgtgggcaagacttccttcctgttccgatacgcggacgactccttcactcccgccttcgtcagtactgtgggcatcgatttcaaggtcaagaccgtctaccgccatgacaagaggatcaagctgcagatctgggacacagcgggccaggagcgctaccgcaccatcaccacggcctactaccggggagccatgggcttcctgctcatgtatgacatcgccaatcaggaatcctttgccgctgtgcaggactgggccacgcaaatcaagacctactcctgggacaacgcccaggtcatcctggtggggaacaagtgtgacctggaggacgaacgtgttgtgcctgctgaggatggccggaggctcgccgacgaccttggtttcgagttctttgaagccagtgccaaggagaacatcaatgtgaagcaggtcttcgagcgcctggtggatgtcatctgcgagaagatgaacgagtccctggaacccagctccagctcaggcagcaacgggaaaggcccggccgtgggggatgctccagccccccagcccagcagctgcagctgctag
Sequence Length
660
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,267 Da
NCBI Official Full Name
Homo sapiens RAB3D, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB3D, member RAS oncogene family
NCBI Official Symbol
RAB3D
NCBI Official Synonym Symbols
GOV; D2-2; RAB16; RAD3D
NCBI Protein Information
ras-related protein Rab-3D
UniProt Protein Name
Ras-related protein Rab-3D
Protein Family
UniProt Gene Name
RAB3D
UniProt Synonym Gene Names
GOV; RAB16
UniProt Entry Name
RAB3D_HUMAN
Uniprot Description
RAB3D: Protein transport. Probably involved in regulated exocytosis. Belongs to the small GTPase superfamily. Rab family.
Protein type: G protein, monomeric, Rab; G protein, monomeric
Chromosomal Location of Human Ortholog: 19p13.2
Cellular Component: cytoplasmic microtubule
Molecular Function: GTPase activity; myosin V binding
Biological Process: bone resorption
Research Articles on RAB3D
Similar Products
Product Notes
The RAB3D rab3d (Catalog #AAA1270421) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcag ctggagacac ccaggcaggc ccacgggatg cagcagatca gaacttcgac tatatgttca aactgctact gataggcaac agcagtgtgg gcaagacttc cttcctgttc cgatacgcgg acgactcctt cactcccgcc ttcgtcagta ctgtgggcat cgatttcaag gtcaagaccg tctaccgcca tgacaagagg atcaagctgc agatctggga cacagcgggc caggagcgct accgcaccat caccacggcc tactaccggg gagccatggg cttcctgctc atgtatgaca tcgccaatca ggaatccttt gccgctgtgc aggactgggc cacgcaaatc aagacctact cctgggacaa cgcccaggtc atcctggtgg ggaacaagtg tgacctggag gacgaacgtg ttgtgcctgc tgaggatggc cggaggctcg ccgacgacct tggtttcgag ttctttgaag ccagtgccaa ggagaacatc aatgtgaagc aggtcttcga gcgcctggtg gatgtcatct gcgagaagat gaacgagtcc ctggaaccca gctccagctc aggcagcaac gggaaaggcc cggccgtggg ggatgctcca gccccccagc ccagcagctg cagctgctag. It is sometimes possible for the material contained within the vial of "RAB3D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
