Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ART3 cdna clone

ART3 cDNA Clone

Gene Names
ART3; ARTC3
Synonyms
ART3; ART3 cDNA Clone; ART3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagacgggacattttgaaatagtcaccatgctgctggcaaccatgattctagtggacattttccaggtgaaggctgaagtgttagacatggcagataatgcatttgatgatgaatacctgaaatgtacggacaggatggaaattaaatacgttccccaactgctaaaggaggaaaaagcaagccaccagcaattagatactgtgtgggaaaatgcaaaagccaaatgggcagcccgaaagactcaaatctttctccctatgaattttaaggataaccatggaatagccctgatggcatatatttccgaagctcaagagcaaactcccttttaccatctgttcagtgaagctgtgaagatggctggccaatctcgagaagattatatctatggcttccagttcaaagctttccacttttacctcacaagagccctgcagttgctgagaaaaccttgtgaggccagttccaaaactgtggtatatagaacaagccagggcacttcatttacatttggagggctaaaccaagccaggtttggccattttaccttggcatattcagccaaacctcaggctgctaatgaccagctcactgtgttatccatctacacatgccttggagttgacattgaaaattttcttgataaagaaagtgaaagaattactttaatacctctgaatgaggtttttcaagtgtcacaggagggggctggcaataaccttatccttcaaagcataaacaagacctgcagccattatgagtgtgcatttctaggtggactaaaaaccgaaaactgtattgagaacctagaatattttcaacccatctatgtctacaaccctggtgagaaaaaccagaagcttgaagaccatagtgagaaaaactggaagcttgaagaccatggtgagaaaaaccagaagcttgaagaccatggtgtgaaaatccttgaacccacccaaatacctgaagataaaagtcaaggaaatatcaacaatcctactccaggtccagttcctgttccaggtcccaaaagccatccttctgcatcctcgggcaaactgctgcttccacagtttgggatggtcatcattttaatcagtgtttctgctataaatctctttgttgctctgtag
Sequence Length
1137
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
419
Molecular Weight
42,716 Da
NCBI Official Full Name
Homo sapiens ADP-ribosyltransferase 3, mRNA
NCBI Official Synonym Full Names
ADP-ribosyltransferase 3
NCBI Official Symbol
ART3
NCBI Official Synonym Symbols
ARTC3
NCBI Protein Information
ecto-ADP-ribosyltransferase 3
UniProt Protein Name
Ecto-ADP-ribosyltransferase 3
UniProt Gene Name
ART3
UniProt Synonym Gene Names
TMART; ARTC3
UniProt Entry Name
NAR3_HUMAN

NCBI Description

This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

ART3: an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Protein type: EC 2.4.2.31; Membrane protein, integral; Transferase; Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 4q21.1|4p15.1-p14

Cellular Component: integral to plasma membrane

Molecular Function: NAD+ ADP-ribosyltransferase activity

Research Articles on ART3

Similar Products

Product Notes

The ART3 art3 (Catalog #AAA1270261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagacgg gacattttga aatagtcacc atgctgctgg caaccatgat tctagtggac attttccagg tgaaggctga agtgttagac atggcagata atgcatttga tgatgaatac ctgaaatgta cggacaggat ggaaattaaa tacgttcccc aactgctaaa ggaggaaaaa gcaagccacc agcaattaga tactgtgtgg gaaaatgcaa aagccaaatg ggcagcccga aagactcaaa tctttctccc tatgaatttt aaggataacc atggaatagc cctgatggca tatatttccg aagctcaaga gcaaactccc ttttaccatc tgttcagtga agctgtgaag atggctggcc aatctcgaga agattatatc tatggcttcc agttcaaagc tttccacttt tacctcacaa gagccctgca gttgctgaga aaaccttgtg aggccagttc caaaactgtg gtatatagaa caagccaggg cacttcattt acatttggag ggctaaacca agccaggttt ggccatttta ccttggcata ttcagccaaa cctcaggctg ctaatgacca gctcactgtg ttatccatct acacatgcct tggagttgac attgaaaatt ttcttgataa agaaagtgaa agaattactt taatacctct gaatgaggtt tttcaagtgt cacaggaggg ggctggcaat aaccttatcc ttcaaagcat aaacaagacc tgcagccatt atgagtgtgc atttctaggt ggactaaaaa ccgaaaactg tattgagaac ctagaatatt ttcaacccat ctatgtctac aaccctggtg agaaaaacca gaagcttgaa gaccatagtg agaaaaactg gaagcttgaa gaccatggtg agaaaaacca gaagcttgaa gaccatggtg tgaaaatcct tgaacccacc caaatacctg aagataaaag tcaaggaaat atcaacaatc ctactccagg tccagttcct gttccaggtc ccaaaagcca tccttctgca tcctcgggca aactgctgct tccacagttt gggatggtca tcattttaat cagtgtttct gctataaatc tctttgttgc tctgtag. It is sometimes possible for the material contained within the vial of "ART3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.