Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GUCA1C cdna clone

GUCA1C cDNA Clone

Gene Names
GUCA1C; GCAP3
Synonyms
GUCA1C; GUCA1C cDNA Clone; GUCA1C cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGGAATGGCAAATCTATAGCTGGTGATCAGAAAGCAGTTCCTACACAAGAGACCCATGTGTGGTACAGAACATTTATGATGGAATATCCATCCGGCCTGCAAACACTACATGAATTTAAGACACTTTTGGGTCTGCAAGGTCTGAATCAGAAGGCCAATAAACATATTGATCAAGTTTATAATACCTTTGACACGAACAAGGATGGATTTATTGACTTTTTGGAGTTTATTGCTGCTGTAAATCTAATCGTGCAAGAAAAAATGGAGCAAAAATTAAAATGGTATTTTAAGCTGTATGATGCTGATGGAAATGGTTCTATTGACAAAAATGAACTACTGGACATGTTCATGGCGGTACAAGCCCTCAATGGCCAGCAAACTCTGAGTCCTGAAGAATTCATCAACTTGGTGTTCCATAAGATCGATATAAACAATGATGGGGAATTGACTTTAGAAGAATTTATCAATGGCATGGCAAAAGATCAGGATCTCCTGGAGATTGTTTACAAGAGCTTCGACTTCTCCAATGTGCTGAGAGTAATCTGTAATGGGAAGCAGCCAGACATGGAGACAGACTCCTCCAAATCTCCTGACAAGGCTGGTCTAGGGAAGGTGAAAATGAAGTAG
Sequence Length
630
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,484 Da
NCBI Official Full Name
Homo sapiens guanylate cyclase activator 1C, mRNA
NCBI Official Synonym Full Names
guanylate cyclase activator 1C
NCBI Official Symbol
GUCA1C
NCBI Official Synonym Symbols
GCAP3
NCBI Protein Information
guanylyl cyclase-activating protein 3
UniProt Protein Name
Guanylyl cyclase-activating protein 3
UniProt Gene Name
GUCA1C
UniProt Synonym Gene Names
GCAP3; GCAP 3
UniProt Entry Name
GUC1C_HUMAN

Uniprot Description

GUCA1C: Stimulates guanylyl cyclase 1 (GC1) and GC2 when free calcium ions concentration is low and inhibits guanylyl cyclases when free calcium ions concentration is elevated. This Ca(2+)- sensitive regulation of guanylyl cyclase (GC) is a key event in recovery of the dark state of rod photoreceptors following light exposure. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Calcium-binding; Activator

Chromosomal Location of Human Ortholog: 3q13.1

Biological Process: regulation of rhodopsin mediated signaling; signal transduction

Research Articles on GUCA1C

Similar Products

Product Notes

The GUCA1C guca1c (Catalog #AAA1270243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGGAATG GCAAATCTAT AGCTGGTGAT CAGAAAGCAG TTCCTACACA AGAGACCCAT GTGTGGTACA GAACATTTAT GATGGAATAT CCATCCGGCC TGCAAACACT ACATGAATTT AAGACACTTT TGGGTCTGCA AGGTCTGAAT CAGAAGGCCA ATAAACATAT TGATCAAGTT TATAATACCT TTGACACGAA CAAGGATGGA TTTATTGACT TTTTGGAGTT TATTGCTGCT GTAAATCTAA TCGTGCAAGA AAAAATGGAG CAAAAATTAA AATGGTATTT TAAGCTGTAT GATGCTGATG GAAATGGTTC TATTGACAAA AATGAACTAC TGGACATGTT CATGGCGGTA CAAGCCCTCA ATGGCCAGCA AACTCTGAGT CCTGAAGAAT TCATCAACTT GGTGTTCCAT AAGATCGATA TAAACAATGA TGGGGAATTG ACTTTAGAAG AATTTATCAA TGGCATGGCA AAAGATCAGG ATCTCCTGGA GATTGTTTAC AAGAGCTTCG ACTTCTCCAA TGTGCTGAGA GTAATCTGTA ATGGGAAGCA GCCAGACATG GAGACAGACT CCTCCAAATC TCCTGACAAG GCTGGTCTAG GGAAGGTGAA AATGAAGTAG. It is sometimes possible for the material contained within the vial of "GUCA1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.