Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERN1 cdna clone

ERN1 cDNA Clone

Gene Names
ERN1; IRE1; IRE1P; IRE1a; hIRE1p
Synonyms
ERN1; ERN1 cDNA Clone; ERN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggcccggcggctgctgctgctgctgacgctgctgctgcccggcctcgggatttttggaagtaccagcacagtgacgcttcctgaaaccttgttgtttgtgtcaacgctggatggaagtttgcatgctgtcagcaagaggacaggctcaatcaaatggactttaaaagaagatccagtcctgcaggtcccaacacatgtggaagagcctgcctttctcccagatcctaatgatggcagcctgtatacgcttggaagcaagaataatgaaggcctgacgaaacttccttttaccatcccagaattggtgcaggcatccccatgccgaagttcagatggaatcctctacatgggtaaaaagcaggacatctggtatgttattgacctcctgaccggagagaagcagcagactttgtcatcggcctttgcagatagtctctgcccatcaacctctcttctgtatcttgggcgaacagaatacaccatcaccatgtacgacaccaaaacccgagagctccggtggaatgccacctactttgactatgcggcctcactgcctgaggacgacgtggactacaagatgtcccactttgtgtccaatggtgatgggctggtggtgactgtggacagtgaatctggggacgtcctgtggatccaaaactacgcctcccctgtggtggccttttatgtctggcagcgggagggtctgaggaaggtgatgcacatcaatgtcgctgtggagaccctgcgctatctgaccttcatgtctggggaggtggggcgcatcacaaagtggaagtacccgttccccaaggagacagaggccaagagcaagctgacgcccactctgtatgttgggaaatactctaccagcctctatgcctctccctcaatggtacacgagggggttgctgtcgtgccccgcggcagcacacttcctttgctggaagggccccagactgatggcgtcaccatcggggacaagggggagtgtgtgatcacgcccagcacggacgtcaagtttgatcccggactcaaaagcaagaacaagctcaactacttgaggaattactggcttctgataggacaccatgaaaccccactgtctgcgtctaccaagatgctggagagatttcccaacaatctacccaaacatcgggaaaatgtgattcctgctgattcagagaaaaagagctttgaggaagttatcaacctggttgaccagacttcagaaaacgcacctaccaccgtgtctcgggatgtggaggagaagcccgcccatgcccctgcccggcccgaggcccccgtggactccatgcttaaggacatggctaccatcatcctgagcaccttcctgctgattggctgggtggccttcatcatcacctatcccctgagcatgcatcagcagcagcagctccagcaccagcagttccagaaggaactggagaagatccagctcctgcagcagcagcagcagcagctgcccttccacccacctggagacacggctcaggacggcgagctcctggacacgtctggcccgtactcagagagctcgggcaccagcagccccagcacgtcccccagggcctccaaccactcgctctgctccggcagctctgcctccaaggctggcagcagcccctccctggaacaagacgatggagatgaggaaaccagcgtggtgatagttgggaaaatttccttctgtcccaaggatgtcctgggccatggagctgagggcacaattgtgtaccggggcatgtttgacaaccgcgacgtggccgtgaagaggatcctccccgagtgttttagcttcgcagaccgtgaggtccagctgttgcgagaatcggatgagcacccgaacgtgatccgctacttctgcacggagaaggaccggcaattccagtacattgccatcgagctgtgtgcagccaccctgcaagagtatgtggagcagaaggactttgcgcatctcggcctggagcccatcaccttgctgcagcagaccacctcgggcctggcccacctccactccctcaacatcgttcacagagacctaaagccacacaacatcctcatatccatgcccaatgcacacggcaagatcaaggccatgatctccgactttggcctctgcaagaagctggcagtgggcagacacagtttcagccgccgatctggggtgcctggcacagaaggctggatcgctccagagatgctgagcgaagactgtaaggagaaccctacctacacggtggacatcttttctgcaggctgcgtcttttactacgtaatctctgagggcagccacccttttggcaagtccctgcagcggcaggccaacatcctcctgggtgcctgcagccttgactgcttgcacccagagaagcacgaagacgtcattgcacgtgaattgatagagaagatgattgcgatggatcctcagaaacgcccctcagcgaagcacgtgctcaaacacccgttcttctggagcctagagaagcagctccagttcttccaggacgtgagcgacagaatagaaaaggaatccctggatggcccgatcgtgaagcagttagagagaggcgggagagccgtggtgaagatggactggcgggagaacatcactgtccccctccagacagacctgcgtaaattcaggacctataaaggtggttctgtcagagatctcctccgagccatgagaaataagaagcaccactaccgggagctgcctgcagaggtgcgggagacgctggggtccctccccgacgacttcgtgtgctacttcacatctcgcttcccccacctcctcgcacacacctaccgggccatggagctgtgcagccacgagagactcttccagccctactacttccacgagcccccagagccccagcccccagtgactccagacgccctctga
Sequence Length
2934
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
6,649 Da
NCBI Official Full Name
Homo sapiens endoplasmic reticulum to nucleus signaling 1, mRNA
NCBI Official Synonym Full Names
endoplasmic reticulum to nucleus signaling 1
NCBI Official Symbol
ERN1
NCBI Official Synonym Symbols
IRE1; IRE1P; IRE1a; hIRE1p
NCBI Protein Information
serine/threonine-protein kinase/endoribonuclease IRE1
UniProt Protein Name
Serine/threonine-protein kinase/endoribonuclease IRE1
UniProt Gene Name
ERN1
UniProt Synonym Gene Names
hIRE1p; IRE1a
UniProt Entry Name
ERN1_HUMAN

NCBI Description

The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]

Uniprot Description

IRE1: a ser/thr protein kinase that possess endonuclease activity. Important in altering gene expression as a response to endoplasmic reticulum based stress signals. Senses unfolded proteins in the lumen of the endoplasmic reticulum via its N-terminal domain, which leads to enzyme auto-activation. The active endoribonuclease domain splices XBP1 mRNA to generate a new C-terminus, converting it into a potent unfolded-protein response transcriptional activator and triggering growth arrest and apoptosis. The kinase domain is activated by trans-autophosphorylation. Kinase activity is required for activation of the endoribonuclease domain. Ubiquitously expressed. High levels observed in pancreatic tissue. Functionally connected with insulin biosynthesis in pancreatic beta cells. Homodimer; disulfide-linked. Dimer formation is driven by hydrophobic interactions within the N-terminal luminal domains and stabilized by disulfide bridges. Also binds HSPA5, a negative regulator of the unfolded protein response. This interaction may disrupt homodimerization and prevent activation of IRE1.

Protein type: Ribonuclease; Endoplasmic reticulum; Kinase, protein; Protein kinase, Other; Apoptosis; Protein kinase, Ser/Thr (non-receptor); Membrane protein, integral; EC 2.7.11.1; Chaperone; Other group; IRE family

Chromosomal Location of Human Ortholog: 17q24.2

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane

Molecular Function: ADP binding; ATP binding; endoribonuclease activity; enzyme binding; Hsp70 protein binding; Hsp90 protein binding; identical protein binding; magnesium ion binding; protein binding; protein homodimerization activity; protein serine/threonine kinase activity

Biological Process: activation of JNK activity; cell cycle arrest; endothelial cell proliferation; mRNA catabolic process; mRNA cleavage; positive regulation of RNA splicing; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of macroautophagy; unfolded protein response, activation of signaling protein activity

Research Articles on ERN1

Similar Products

Product Notes

The ERN1 ern1 (Catalog #AAA1270158) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggccc ggcggctgct gctgctgctg acgctgctgc tgcccggcct cgggattttt ggaagtacca gcacagtgac gcttcctgaa accttgttgt ttgtgtcaac gctggatgga agtttgcatg ctgtcagcaa gaggacaggc tcaatcaaat ggactttaaa agaagatcca gtcctgcagg tcccaacaca tgtggaagag cctgcctttc tcccagatcc taatgatggc agcctgtata cgcttggaag caagaataat gaaggcctga cgaaacttcc ttttaccatc ccagaattgg tgcaggcatc cccatgccga agttcagatg gaatcctcta catgggtaaa aagcaggaca tctggtatgt tattgacctc ctgaccggag agaagcagca gactttgtca tcggcctttg cagatagtct ctgcccatca acctctcttc tgtatcttgg gcgaacagaa tacaccatca ccatgtacga caccaaaacc cgagagctcc ggtggaatgc cacctacttt gactatgcgg cctcactgcc tgaggacgac gtggactaca agatgtccca ctttgtgtcc aatggtgatg ggctggtggt gactgtggac agtgaatctg gggacgtcct gtggatccaa aactacgcct cccctgtggt ggccttttat gtctggcagc gggagggtct gaggaaggtg atgcacatca atgtcgctgt ggagaccctg cgctatctga ccttcatgtc tggggaggtg gggcgcatca caaagtggaa gtacccgttc cccaaggaga cagaggccaa gagcaagctg acgcccactc tgtatgttgg gaaatactct accagcctct atgcctctcc ctcaatggta cacgaggggg ttgctgtcgt gccccgcggc agcacacttc ctttgctgga agggccccag actgatggcg tcaccatcgg ggacaagggg gagtgtgtga tcacgcccag cacggacgtc aagtttgatc ccggactcaa aagcaagaac aagctcaact acttgaggaa ttactggctt ctgataggac accatgaaac cccactgtct gcgtctacca agatgctgga gagatttccc aacaatctac ccaaacatcg ggaaaatgtg attcctgctg attcagagaa aaagagcttt gaggaagtta tcaacctggt tgaccagact tcagaaaacg cacctaccac cgtgtctcgg gatgtggagg agaagcccgc ccatgcccct gcccggcccg aggcccccgt ggactccatg cttaaggaca tggctaccat catcctgagc accttcctgc tgattggctg ggtggccttc atcatcacct atcccctgag catgcatcag cagcagcagc tccagcacca gcagttccag aaggaactgg agaagatcca gctcctgcag cagcagcagc agcagctgcc cttccaccca cctggagaca cggctcagga cggcgagctc ctggacacgt ctggcccgta ctcagagagc tcgggcacca gcagccccag cacgtccccc agggcctcca accactcgct ctgctccggc agctctgcct ccaaggctgg cagcagcccc tccctggaac aagacgatgg agatgaggaa accagcgtgg tgatagttgg gaaaatttcc ttctgtccca aggatgtcct gggccatgga gctgagggca caattgtgta ccggggcatg tttgacaacc gcgacgtggc cgtgaagagg atcctccccg agtgttttag cttcgcagac cgtgaggtcc agctgttgcg agaatcggat gagcacccga acgtgatccg ctacttctgc acggagaagg accggcaatt ccagtacatt gccatcgagc tgtgtgcagc caccctgcaa gagtatgtgg agcagaagga ctttgcgcat ctcggcctgg agcccatcac cttgctgcag cagaccacct cgggcctggc ccacctccac tccctcaaca tcgttcacag agacctaaag ccacacaaca tcctcatatc catgcccaat gcacacggca agatcaaggc catgatctcc gactttggcc tctgcaagaa gctggcagtg ggcagacaca gtttcagccg ccgatctggg gtgcctggca cagaaggctg gatcgctcca gagatgctga gcgaagactg taaggagaac cctacctaca cggtggacat cttttctgca ggctgcgtct tttactacgt aatctctgag ggcagccacc cttttggcaa gtccctgcag cggcaggcca acatcctcct gggtgcctgc agccttgact gcttgcaccc agagaagcac gaagacgtca ttgcacgtga attgatagag aagatgattg cgatggatcc tcagaaacgc ccctcagcga agcacgtgct caaacacccg ttcttctgga gcctagagaa gcagctccag ttcttccagg acgtgagcga cagaatagaa aaggaatccc tggatggccc gatcgtgaag cagttagaga gaggcgggag agccgtggtg aagatggact ggcgggagaa catcactgtc cccctccaga cagacctgcg taaattcagg acctataaag gtggttctgt cagagatctc ctccgagcca tgagaaataa gaagcaccac taccgggagc tgcctgcaga ggtgcgggag acgctggggt ccctccccga cgacttcgtg tgctacttca catctcgctt cccccacctc ctcgcacaca cctaccgggc catggagctg tgcagccacg agagactctt ccagccctac tacttccacg agcccccaga gccccagccc ccagtgactc cagacgccct ctga. It is sometimes possible for the material contained within the vial of "ERN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.