Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDKN1A cdna clone

CDKN1A cDNA Clone

Gene Names
CDKN1A; P21; CIP1; SDI1; WAF1; CAP20; CDKN1; MDA-6; p21CIP1
Synonyms
CDKN1A; CDKN1A cDNA Clone; CDKN1A cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagaaccggctggggatgtccgtcagaacccatgcggcagcaaggcctgccgccgcctcttcggcccagtggacagcgagcagctgagccgcgactgtgatgcgctaatggcgggctgcatccaggaggcccgtgagcgatggaacttcgactttgtcaccgagacaccactggagggtgacttcgcctgggagcgtgtgcggggccttggcctgcccaagctctaccttcccacggggccccggcgaggccgggatgagttgggaggaggcaggcggcctggcacctcacctgctctgctgcaggggacagcagaggaagaccatgtggacctgtcactgtcttgtacccttgtgcctcgctcaggggagcaggctgaagggtccccaggtggacctggagactctcagggtcgaaaacggcggcagaccagcatgacagatttctaccactccaaacgccggctgatcttctccaagaggaagccctaa
Sequence Length
495
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,119 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1), mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase inhibitor 1A
NCBI Official Symbol
CDKN1A
NCBI Official Synonym Symbols
P21; CIP1; SDI1; WAF1; CAP20; CDKN1; MDA-6; p21CIP1
NCBI Protein Information
cyclin-dependent kinase inhibitor 1
UniProt Protein Name
Cyclin-dependent kinase inhibitor 1
UniProt Gene Name
CDKN1A
UniProt Synonym Gene Names
CAP20; CDKN1; CIP1; MDA6; PIC1; SDI1; WAF1; MDA-6
UniProt Entry Name
CDN1A_HUMAN

NCBI Description

This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or -cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2015]

Uniprot Description

p21Cip1: a cell-cycle regulatory protein that Interacts with cyclin-CDK2 and -CDK4, inhibiting cell cycle progression at G1. Its expression is tightly controlled by p53, through which this protein mediates the p53-dependent cell cycle arrest at G1 phase.

Protein type: Inhibitor; Cell cycle regulation

Chromosomal Location of Human Ortholog: 6p21.2

Cellular Component: cyclin-dependent protein kinase holoenzyme complex; cytosol; nucleoplasm; nucleus

Molecular Function: cyclin-dependent protein kinase activating kinase activity; cyclin-dependent protein kinase inhibitor activity; protein binding; ubiquitin protein ligase binding

Biological Process: cell cycle arrest; cellular response to amino acid starvation; cellular response to extracellular stimulus; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; G1/S transition of mitotic cell cycle; G2/M transition of mitotic cell cycle; negative regulation of cell growth; negative regulation of cell proliferation; negative regulation of phosphorylation; positive regulation of fibroblast proliferation; protein stabilization; Ras protein signal transduction; regulation of cyclin-dependent protein kinase activity; response to DNA damage stimulus

Research Articles on CDKN1A

Similar Products

Product Notes

The CDKN1A cdkn1a (Catalog #AAA1270157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagaac cggctgggga tgtccgtcag aacccatgcg gcagcaaggc ctgccgccgc ctcttcggcc cagtggacag cgagcagctg agccgcgact gtgatgcgct aatggcgggc tgcatccagg aggcccgtga gcgatggaac ttcgactttg tcaccgagac accactggag ggtgacttcg cctgggagcg tgtgcggggc cttggcctgc ccaagctcta ccttcccacg gggccccggc gaggccggga tgagttggga ggaggcaggc ggcctggcac ctcacctgct ctgctgcagg ggacagcaga ggaagaccat gtggacctgt cactgtcttg tacccttgtg cctcgctcag gggagcaggc tgaagggtcc ccaggtggac ctggagactc tcagggtcga aaacggcggc agaccagcat gacagatttc taccactcca aacgccggct gatcttctcc aagaggaagc cctaa. It is sometimes possible for the material contained within the vial of "CDKN1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.