Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BUB1B cdna clone

BUB1B cDNA Clone

Gene Names
BUB1B; MVA1; SSK1; BUBR1; Bub1A; MAD3L; hBUBR1; BUB1beta
Synonyms
BUB1B; BUB1B cDNA Clone; BUB1B cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggtgaagaaggaagggggtgctctgagtgaagccatgtccctggagggagatgaatgggaactgagtaaagaaaatgtacaacctttaaggcaagggcggatcatgtccacgcttcagggagcactggcacaagaatctgcctgtaacaatactcttcagcagcagaaacgggcatttgaatatgaaattcgattttacactggaaatgaccctctggatgtttgggataggtatatcagctggacagagcagaactatcctcaaggtgggaaggagagtaatatgtcaacgttattagaaagagctgtagaagcactacaaggagaaaaacgatattatagtgatcctcgatttctcaatctctggcttaaattagggcgtttatgcaatgagcctttggatatgtacagttacttgcacaaccaagggattggtgtttcacttgctcagttctatatctcatgggcagaagaatatgaagctagagaaaactttaggaaagcagatgcgatatttcaggaagggattcaacagaaggctgaaccactagaaagactacagtcccagcaccgacaattccaagctcgagtgtctcggcaaactctgttggcacttgagaaagaagaagaggaggaagtttttgagtcttctgtaccacaacgaagcacactagctgaactaaagagcaaagggaaaaagacagcaagagctccaatcatccgtgtaggaggtgctctcaaggctccaagccagaacagaggactccaaaatccatttcctcaacagatgcaaaataatagtagaattactgtttttgatgaaaatgctgatgaggcttctacagcagagttgtctaagcctacagtccagccatggatagcaccccccatgcccagggccaaagagaatgagctgcaagcaggcccttggaacacaggcaggtccttggaacacaggcctcgtggcaatacagcttcactgatagctgtacccgctgtgcttcccagtttcactccatatgtggaagagactgcacaacagccagttatgacaccatgtaaaattgaacctagtataaaccacatcctaagcaccagaaagcctggaaaggaagaaggagattctctacaaagggttcagagccatcagcaagcgtctgaggagaagaaagagaagatgatgtattgtaaggagaagatttatgcaggagtaggggaattctcctttgaagaaattcgggctgaagttttccggaagaaattaaaagagcaaagggaagccgagctattgaccagtgcagagaagagagcagaaatgcagaaacagattgaagagatggagaagaagctaaaagaaatccaaactactcagcaagaaagaacaggtgatcagcaagaagagacgatgcctacaaaggagacaactaaactgcaaattgcttccgagtctcagaaaataccaggaatgactctatccagttctgtttgtcaagtaaactgttgtgccagagaaacttcacttgcggagaacatttggcaggaacaacctcattctaaaggtcccagtgtacctttctccatttttgatgagtttcttctttcagaaaagaagaataaaagtcctcctgcagatcccccacgagttttagctcaacgaagaccccttgcagttctcaaaacctcagaaagcatcacctcaaatgaagatgtgtctccagatgtttgtgatgaatttacaggaattgaacccttgagcgaggatgccattatcacaggcttcagaaatgtaacaatttgtcctaacccagaagacacttgtgactttgccagagcagctcgttttgtatccactccttttcatgagataatgtccttgaaggatctcccttctgatcctgagagactgttaccggaagaagatctagatgtaaagacctctgaggaccagcagacagcttgtggcactatctacagtcagactctcagcatcaagaagctgagcccaattattgaagacagtcgtgaagccacacactcctctggcttctctggttcttctgcctcggttgcaagcacctcctccatcaaatgtcttcaaattcctgagaaactagaacttactaatgagacttcagaaaaccctactcagtcaccatggtgttcacagtatcgcagacagctactgaagtccctaccagagttaagtgcctctgcagagttgtgtatagaagacagaccaatgcctaagttggaaattgagaaggaaattgaattaggtaatgaggattactgcattaaacgagaatacctaatatgtgaagattacaagttattctgggtggcgccaagaaactctgcagaattaacagtaataaaggtatcttctcaacctgtcccatgggacttttatatcaacctcaagttaaaggaacgtttaaatgaagattttgatcatttttgcagctgttatcaatatcaagatggctgtattgtttggcaccaatatataaactgcttcacccttcaggatcttctccaacacagtgaatatattacccatgaaataacagtgttgattatttataaccttttgacaatagtggagatgctacacaaagcagaaatagtccatggtgacttgagtccaaggtgtctgattctcagaaacagaatccacgatccctatgattgtaacaagaacaatcaagctttgaagatagtggacttttcctacagtgttgaccttagggtgcagctggatgtttttaccctcagcggctttcggactgtacagatcctggaaggacaaaagatcctggctaactgttcttctccctaccaggtagacctgtttggtatagcagatttagcacatttactattgttcaaggaacacctacaggtcttctgggatgggtccttctggaaacttagccaaaatatttctgagctaaaagatggtgaattgtggaataaattctttgtgcggattctgaatgccaatgatgaggccacagtgtctgttcttggggagcttgcagcagaaatgaatggggtttttgacactacattccaaagtcacctgaacaaagccttatggaaggtagggaagttaactagtcctggggctttgctctttcagtga
Sequence Length
3153
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
701
Molecular Weight
121,386 Da
NCBI Official Full Name
Homo sapiens budding uninhibited by benzimidazoles 1 homolog beta (yeast), mRNA
NCBI Official Synonym Full Names
BUB1 mitotic checkpoint serine/threonine kinase B
NCBI Official Symbol
BUB1B
NCBI Official Synonym Symbols
MVA1; SSK1; BUBR1; Bub1A; MAD3L; hBUBR1; BUB1beta
NCBI Protein Information
mitotic checkpoint serine/threonine-protein kinase BUB1 beta
UniProt Protein Name
Mitotic checkpoint serine/threonine-protein kinase BUB1 beta
UniProt Gene Name
BUB1B
UniProt Synonym Gene Names
BUBR1; MAD3L; SSK1; hBUBR1
UniProt Entry Name
BUB1B_HUMAN

NCBI Description

This gene encodes a kinase involved in spindle checkpoint function. The protein has been localized to the kinetochore and plays a role in the inhibition of the anaphase-promoting complex/cyclosome (APC/C), delaying the onset of anaphase and ensuring proper chromosome segregation. Impaired spindle checkpoint function has been found in many forms of cancer. [provided by RefSeq, Jul 2008]

Uniprot Description

BUB1B: Essential component of the mitotic checkpoint. Required for normal mitosis progression. The mitotic checkpoint delays anaphase until all chromosomes are properly attached to the mitotic spindle. One of its checkpoint functions is to inhibit the activity of the anaphase-promoting complex/cyclosome (APC/C) by blocking the binding of CDC20 to APC/C, independently of its kinase activity. The other is to monitor kinetochore activities that depend on the kinetochore motor CENPE. Required for kinetochore localization of CENPE. Negatively regulates PLK1 activity in interphase cells and suppresses centrosome amplification. Also implicated in triggering apoptosis in polyploid cells that exit aberrantly from mitotic arrest. May play a role for tumor suppression. Interacts with CENPE, CENPF, mitosin, PLK1 and BUB3. Part of a complex containing BUB3, CDC20 and BUB1B. Interacts with anaphase-promoting complex/cyclosome (APC/C). Interacts with CASC5. Induced during mitosis. Highly expressed in thymus followed by spleen. Preferentially expressed in tissues with a high mitotic index. Kinase activity stimulated by CENPE. Belongs to the protein kinase superfamily. Ser/Thr protein kinase family. BUB1 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; EC 2.7.11.1; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, Other; Other group; BUB family

Chromosomal Location of Human Ortholog: 15q15

Cellular Component: anaphase-promoting complex; cytoplasm; cytosol; kinetochore; outer kinetochore of condensed chromosome; perinuclear region of cytoplasm

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cell proliferation; mitotic cell cycle checkpoint; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; sister chromatid cohesion

Disease: Colorectal Cancer; Mosaic Variegated Aneuploidy Syndrome 1; Premature Chromatid Separation Trait

Research Articles on BUB1B

Similar Products

Product Notes

The BUB1B bub1b (Catalog #AAA1270126) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg tgaagaagga agggggtgct ctgagtgaag ccatgtccct ggagggagat gaatgggaac tgagtaaaga aaatgtacaa cctttaaggc aagggcggat catgtccacg cttcagggag cactggcaca agaatctgcc tgtaacaata ctcttcagca gcagaaacgg gcatttgaat atgaaattcg attttacact ggaaatgacc ctctggatgt ttgggatagg tatatcagct ggacagagca gaactatcct caaggtggga aggagagtaa tatgtcaacg ttattagaaa gagctgtaga agcactacaa ggagaaaaac gatattatag tgatcctcga tttctcaatc tctggcttaa attagggcgt ttatgcaatg agcctttgga tatgtacagt tacttgcaca accaagggat tggtgtttca cttgctcagt tctatatctc atgggcagaa gaatatgaag ctagagaaaa ctttaggaaa gcagatgcga tatttcagga agggattcaa cagaaggctg aaccactaga aagactacag tcccagcacc gacaattcca agctcgagtg tctcggcaaa ctctgttggc acttgagaaa gaagaagagg aggaagtttt tgagtcttct gtaccacaac gaagcacact agctgaacta aagagcaaag ggaaaaagac agcaagagct ccaatcatcc gtgtaggagg tgctctcaag gctccaagcc agaacagagg actccaaaat ccatttcctc aacagatgca aaataatagt agaattactg tttttgatga aaatgctgat gaggcttcta cagcagagtt gtctaagcct acagtccagc catggatagc accccccatg cccagggcca aagagaatga gctgcaagca ggcccttgga acacaggcag gtccttggaa cacaggcctc gtggcaatac agcttcactg atagctgtac ccgctgtgct tcccagtttc actccatatg tggaagagac tgcacaacag ccagttatga caccatgtaa aattgaacct agtataaacc acatcctaag caccagaaag cctggaaagg aagaaggaga ttctctacaa agggttcaga gccatcagca agcgtctgag gagaagaaag agaagatgat gtattgtaag gagaagattt atgcaggagt aggggaattc tcctttgaag aaattcgggc tgaagttttc cggaagaaat taaaagagca aagggaagcc gagctattga ccagtgcaga gaagagagca gaaatgcaga aacagattga agagatggag aagaagctaa aagaaatcca aactactcag caagaaagaa caggtgatca gcaagaagag acgatgccta caaaggagac aactaaactg caaattgctt ccgagtctca gaaaatacca ggaatgactc tatccagttc tgtttgtcaa gtaaactgtt gtgccagaga aacttcactt gcggagaaca tttggcagga acaacctcat tctaaaggtc ccagtgtacc tttctccatt tttgatgagt ttcttctttc agaaaagaag aataaaagtc ctcctgcaga tcccccacga gttttagctc aacgaagacc ccttgcagtt ctcaaaacct cagaaagcat cacctcaaat gaagatgtgt ctccagatgt ttgtgatgaa tttacaggaa ttgaaccctt gagcgaggat gccattatca caggcttcag aaatgtaaca atttgtccta acccagaaga cacttgtgac tttgccagag cagctcgttt tgtatccact ccttttcatg agataatgtc cttgaaggat ctcccttctg atcctgagag actgttaccg gaagaagatc tagatgtaaa gacctctgag gaccagcaga cagcttgtgg cactatctac agtcagactc tcagcatcaa gaagctgagc ccaattattg aagacagtcg tgaagccaca cactcctctg gcttctctgg ttcttctgcc tcggttgcaa gcacctcctc catcaaatgt cttcaaattc ctgagaaact agaacttact aatgagactt cagaaaaccc tactcagtca ccatggtgtt cacagtatcg cagacagcta ctgaagtccc taccagagtt aagtgcctct gcagagttgt gtatagaaga cagaccaatg cctaagttgg aaattgagaa ggaaattgaa ttaggtaatg aggattactg cattaaacga gaatacctaa tatgtgaaga ttacaagtta ttctgggtgg cgccaagaaa ctctgcagaa ttaacagtaa taaaggtatc ttctcaacct gtcccatggg acttttatat caacctcaag ttaaaggaac gtttaaatga agattttgat catttttgca gctgttatca atatcaagat ggctgtattg tttggcacca atatataaac tgcttcaccc ttcaggatct tctccaacac agtgaatata ttacccatga aataacagtg ttgattattt ataacctttt gacaatagtg gagatgctac acaaagcaga aatagtccat ggtgacttga gtccaaggtg tctgattctc agaaacagaa tccacgatcc ctatgattgt aacaagaaca atcaagcttt gaagatagtg gacttttcct acagtgttga ccttagggtg cagctggatg tttttaccct cagcggcttt cggactgtac agatcctgga aggacaaaag atcctggcta actgttcttc tccctaccag gtagacctgt ttggtatagc agatttagca catttactat tgttcaagga acacctacag gtcttctggg atgggtcctt ctggaaactt agccaaaata tttctgagct aaaagatggt gaattgtgga ataaattctt tgtgcggatt ctgaatgcca atgatgaggc cacagtgtct gttcttgggg agcttgcagc agaaatgaat ggggtttttg acactacatt ccaaagtcac ctgaacaaag ccttatggaa ggtagggaag ttaactagtc ctggggcttt gctctttcag tga. It is sometimes possible for the material contained within the vial of "BUB1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.