RIMKLA cdna clone
RIMKLA cDNA Clone
Gene Names
RIMKLA; NAAGS; FAM80A; NAAGS-II
Synonyms
RIMKLA; RIMKLA cDNA Clone; RIMKLA cdna clone
Sequence
atggaccagatcgccgtcaccatcgtcggcggccacctcggcctccagctaaaccagaaggccctcaccactttcccggatgtggtgcttgtacgggtacccacaccctcagtgcagtcagacagtgacatcactgtcctgcgacacctggagaagctgggctgccggttggtcaatcgcccacagagcatcttaaattgcatcaacaaattctggacgttccaagaactggctggacatggggtccccatgccagacaccttctcctatggtgggcatgaagacttttcaaaaatgattgatgaagctgagcccctgggctacccagtcgtggtgaagagcacacgaggccaccggggaaaagctgtttttctggcaagagataaacatcacctctctgacatctgccatctgatccgccacgatgtgccctacctgttccagaagtacgtgaaggagtcccatggaaaggacatccgggtggtggtggtagggggccaggtcataggctctatgcttcgctgctccactgatggacggatgcagagcaactgctctctcggtggcgtgggcgtcaagtgtccgctgacagaacaaggcaagcagttggctattcaggtgtccaacatcctaggcatggacttctgtggcattgatctccttatcatggacgatggctcctttgtggtgtgtgaggcaaatgctaatgttggcttcctagcctttgaccaggcatgcaacttagatgtgggtgggatcattgcagactataccatgtccttgctgccaaataggcagactggaaagatggctgtcctcccaggactgtcgagtccaagggagaagaacgagccggatggctgtgcttcagctcagggagttgcagagagcgtctataccatcaacagtgggtctacctctagcgaaagtgagcctgaactgggagagatccgggattcctcagcaagcacaatgggggccccaccctccatgctgcccgaacctggctacaacattaacaacaggattgcttctgagttaaaacttaagtga
Sequence Length
1053
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,864 Da
NCBI Official Full Name
Homo sapiens ribosomal modification protein rimK-like family member A, mRNA
NCBI Official Synonym Full Names
ribosomal modification protein rimK like family member A
NCBI Official Symbol
RIMKLA
NCBI Official Synonym Symbols
NAAGS; FAM80A; NAAGS-II
NCBI Protein Information
N-acetylaspartylglutamate synthase A
UniProt Protein Name
N-acetylaspartylglutamate synthase A
Protein Family
UniProt Gene Name
RIMKLA
UniProt Synonym Gene Names
FAM80A; NAAG synthetase A; NAAGS
UniProt Entry Name
RIMKA_HUMAN
Uniprot Description
FAM80A: Catalyzes the synthesis of N-acetylaspartyl-glutamate (NAAG). Belongs to the RimK family.
Protein type: EC 6.3.2.41; EC 6.3.2.42
Chromosomal Location of Human Ortholog: 1p34.2
Similar Products
Product Notes
The RIMKLA rimkla (Catalog #AAA1270026) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccaga tcgccgtcac catcgtcggc ggccacctcg gcctccagct aaaccagaag gccctcacca ctttcccgga tgtggtgctt gtacgggtac ccacaccctc agtgcagtca gacagtgaca tcactgtcct gcgacacctg gagaagctgg gctgccggtt ggtcaatcgc ccacagagca tcttaaattg catcaacaaa ttctggacgt tccaagaact ggctggacat ggggtcccca tgccagacac cttctcctat ggtgggcatg aagacttttc aaaaatgatt gatgaagctg agcccctggg ctacccagtc gtggtgaaga gcacacgagg ccaccgggga aaagctgttt ttctggcaag agataaacat cacctctctg acatctgcca tctgatccgc cacgatgtgc cctacctgtt ccagaagtac gtgaaggagt cccatggaaa ggacatccgg gtggtggtgg tagggggcca ggtcataggc tctatgcttc gctgctccac tgatggacgg atgcagagca actgctctct cggtggcgtg ggcgtcaagt gtccgctgac agaacaaggc aagcagttgg ctattcaggt gtccaacatc ctaggcatgg acttctgtgg cattgatctc cttatcatgg acgatggctc ctttgtggtg tgtgaggcaa atgctaatgt tggcttccta gcctttgacc aggcatgcaa cttagatgtg ggtgggatca ttgcagacta taccatgtcc ttgctgccaa ataggcagac tggaaagatg gctgtcctcc caggactgtc gagtccaagg gagaagaacg agccggatgg ctgtgcttca gctcagggag ttgcagagag cgtctatacc atcaacagtg ggtctacctc tagcgaaagt gagcctgaac tgggagagat ccgggattcc tcagcaagca caatgggggc cccaccctcc atgctgcccg aacctggcta caacattaac aacaggattg cttctgagtt aaaacttaag tga. It is sometimes possible for the material contained within the vial of "RIMKLA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
