Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIP4 cdna clone

TRIP4 cDNA Clone

Gene Names
TRIP4; ASC1; ASC-1; MDCDC; SMABF1; ZC2HC5; HsT17391
Synonyms
TRIP4; TRIP4 cDNA Clone; TRIP4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtggctggggcggtgtccggggagccgctggtgcactggtgcacccagcagttgcggaagactttcggcctggatgtcagcgaggagatcattcagtacgttttgtcaattgagagtgctgaagagatacgagaatatgttactgatctcctccagggaaatgaaggcaaaaaaggtcaattcatagaagaacttataaccaaatggcaaaagaatgatcaggagttgatttcggatcctttgcagcagtgcttcaaaaaagatgaaattttagatgggcagaaatcaggcgaccatctaaagcggggtaggaagaaagggagaaacagacaggaagttcctgcatttactgaacctgacacgactgcagaggttaaaacaccttttgatttggccaaggcacaagagaacagcaactccgtaaagaagaagacaaagtttgtcaatttatacacaagagagggacaggacaggcttgcagtcctgctccctggtcgtcacccttgtgattgcctgggccagaagcacaagctcatcaataactgtctgatctgtgggcgcattgtctgtgaacaagaaggctcaggcccttgcttattctgtggcactctggtgtgtactcatgaggaacaagatattttacagcgtgactcaaacaagagccagaaactgctaaagaaactcatgtcaggagtggagaattctggaaaggtggacatctctaccaaggaccttcttcctcatcaagaattgcgaattaagtctggtctggagaaggctatcaagcataaagacaaactgttagagtttgacagaactagtattcgaaggacccaagtcattgatgatgagtcagattactttgccagtgattctaaccaatggttgtccaaacttgagcgggaaaccttgcagaagcgagaggaggagctgagagaacttcgacacgcctctcgactttctaagaaggtcaccattgactttgcaggaaggaagatcctggaagaagaaaattcactagcagagtatcatagcagactagatgagacaatacaggccattgccaatggaaccttgaaccagccactgaccaaattggatagatcttctgaagagcctttgggagttctggtaaatcccaacatgtaccagtcccctccccagtgggttgaccacacaggtgcagcctcacagaagaaggctttccgttcttcaggatttggactagagttcaactcatttcagcaccagctgcgaatccaggatcaagaatttcaggaaggctttgatggtggctggtgcctctctgtacatcagccctgggcttctctgcttgtcagagggattaaaagggtggagggcagatcctggtacaccccccacagaggacgactttggatagcagccacagctaaaaaaccctcccctcaagaagtctcagaactccaggctacatatcgtcttcttcgtgggaaagatgtggaatttcctaatgactatccgtcaggttgtcttctgggctgtgtggacctaattgactgcttgtcccagaagcaatttaaggagcagtttccagacatcagtcaagaatctgattctccatttgttttcatctgcaaaaatcctcaggaaatggttgtgaagtttcctattaaaggaaatccaaaaatctggaaattggattccaagatccatcaaggagcaaagaaggggttaatgaagcagaataaagctgtctga
Sequence Length
1746
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,146 Da
NCBI Official Full Name
Homo sapiens thyroid hormone receptor interactor 4, mRNA
NCBI Official Synonym Full Names
thyroid hormone receptor interactor 4
NCBI Official Symbol
TRIP4
NCBI Official Synonym Symbols
ASC1; ASC-1; MDCDC; SMABF1; ZC2HC5; HsT17391
NCBI Protein Information
activating signal cointegrator 1
UniProt Protein Name
Activating signal cointegrator 1
UniProt Gene Name
TRIP4
UniProt Synonym Gene Names
TRIP-4
UniProt Entry Name
TRIP4_HUMAN

NCBI Description

This gene encodes a subunit of the tetrameric nuclear activating signal cointegrator 1 (ASC-1) complex, which associates with transcriptional coactivators, nuclear receptors and basal transcription factors to facilitate nuclear receptors-mediated transcription. This protein is localized in the nucleus and contains an E1A-type zinc finger domain, which mediates interaction with transcriptional coactivators and ligand-bound nuclear receptors, such as thyroid hormone receptor and retinoid X receptor alpha, but not glucocorticoid receptor. Mutations in this gene are associated with spinal muscular atrophy with congenital bone fractures-1 (SMABF1). [provided by RefSeq, Apr 2016]

Uniprot Description

TRIP4: thyroid receptor interacting protein 4 is a transcription coactivator of nuclear receptors including thyroid hormone receptor. Functions in conjunction with CBP-p300 and SRC-1. Plays a pivotal role in the transactivation of NF-kappa-B, SRF and AP1. Acts as a mediator of transrepression between nuclear receptor and either AP1 or NF-kappa-B. Plays a role in androgen receptor transactivation and in testicular function

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 15q22.31

Cellular Component: cytoplasm; neuromuscular junction; nucleoplasm; nucleus; transcription factor complex

Molecular Function: estrogen receptor binding; histone acetyltransferase binding; ligand-dependent nuclear receptor binding; protease binding; protein binding; transcription coactivator activity

Biological Process: estrogen receptor signaling pathway; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent

Disease: Spinal Muscular Atrophy With Congenital Bone Fractures 1

Research Articles on TRIP4

Similar Products

Product Notes

The TRIP4 trip4 (Catalog #AAA1270017) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgg ctggggcggt gtccggggag ccgctggtgc actggtgcac ccagcagttg cggaagactt tcggcctgga tgtcagcgag gagatcattc agtacgtttt gtcaattgag agtgctgaag agatacgaga atatgttact gatctcctcc agggaaatga aggcaaaaaa ggtcaattca tagaagaact tataaccaaa tggcaaaaga atgatcagga gttgatttcg gatcctttgc agcagtgctt caaaaaagat gaaattttag atgggcagaa atcaggcgac catctaaagc ggggtaggaa gaaagggaga aacagacagg aagttcctgc atttactgaa cctgacacga ctgcagaggt taaaacacct tttgatttgg ccaaggcaca agagaacagc aactccgtaa agaagaagac aaagtttgtc aatttataca caagagaggg acaggacagg cttgcagtcc tgctccctgg tcgtcaccct tgtgattgcc tgggccagaa gcacaagctc atcaataact gtctgatctg tgggcgcatt gtctgtgaac aagaaggctc aggcccttgc ttattctgtg gcactctggt gtgtactcat gaggaacaag atattttaca gcgtgactca aacaagagcc agaaactgct aaagaaactc atgtcaggag tggagaattc tggaaaggtg gacatctcta ccaaggacct tcttcctcat caagaattgc gaattaagtc tggtctggag aaggctatca agcataaaga caaactgtta gagtttgaca gaactagtat tcgaaggacc caagtcattg atgatgagtc agattacttt gccagtgatt ctaaccaatg gttgtccaaa cttgagcggg aaaccttgca gaagcgagag gaggagctga gagaacttcg acacgcctct cgactttcta agaaggtcac cattgacttt gcaggaagga agatcctgga agaagaaaat tcactagcag agtatcatag cagactagat gagacaatac aggccattgc caatggaacc ttgaaccagc cactgaccaa attggataga tcttctgaag agcctttggg agttctggta aatcccaaca tgtaccagtc ccctccccag tgggttgacc acacaggtgc agcctcacag aagaaggctt tccgttcttc aggatttgga ctagagttca actcatttca gcaccagctg cgaatccagg atcaagaatt tcaggaaggc tttgatggtg gctggtgcct ctctgtacat cagccctggg cttctctgct tgtcagaggg attaaaaggg tggagggcag atcctggtac accccccaca gaggacgact ttggatagca gccacagcta aaaaaccctc ccctcaagaa gtctcagaac tccaggctac atatcgtctt cttcgtggga aagatgtgga atttcctaat gactatccgt caggttgtct tctgggctgt gtggacctaa ttgactgctt gtcccagaag caatttaagg agcagtttcc agacatcagt caagaatctg attctccatt tgttttcatc tgcaaaaatc ctcaggaaat ggttgtgaag tttcctatta aaggaaatcc aaaaatctgg aaattggatt ccaagatcca tcaaggagca aagaaggggt taatgaagca gaataaagct gtctga. It is sometimes possible for the material contained within the vial of "TRIP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.