BCL6B cdna clone
BCL6B cDNA Clone
Gene Names
BCL6B; BAZF; ZNF62; ZBTB28
Synonyms
BCL6B; BCL6B cDNA Clone; BCL6B cdna clone
Sequence
atgggttcccccgccgccccggagggagcgctgggctacgtccgcgagttcactcgccactcctccgacgtgctgggcaacctcaacgagctgcgcctgcgcgggatcctcactgacgtcacgctgctggttggcgggcaacccctcagagcacacaaggcagttctcatcgcctgcagtggcttcttctattcaattttccggggccgtgcgggagtcggggtggacgtgctctctctgcccgggggtcccgaagcgagaggcttcgcccctctattggacttcatgtacacttcgcgcctgcgcctctctccagccactgcaccagcagtcctagcggccgccacctatttgcagatggagcacgtggtccaggcatgccaccgcttcatccaggccagctatgaacctctgggcatctccctgcgccccctggaagcagaacccccaacacccccaacggcccctccaccaggtagtcccaggcgctccgaaggacacccagacccacctactgaatctcgaagctgcagtcaaggcccccccagtccagccagccctgaccccaaggcctgcaactggaaaaagtacaagtacatcgtgctaaactctcaggcctcccaagcagggagcctggtcggggagagaagttctggtcaaccttgcccccaagccaggctccccagtggagacgaggcctccagcagcagcagcagcagcagcagcagcagcagtgaagaaggacccattcctggtccccagagcaggctctctccaactgctgccactgtgcagttcaaatgtggggctccagccagtaccccctacctcctcacatcccaggctcaagacacctctggatcaccctctgaacgggctcgtccactaccgggaagtgaatttttcagctgccagaactctgaggctgtggcagggtgctcatcggggctggactccttggttcctggggacgaagacaaaccctataagtgtcagctgtgccggtcttcgttccgctacaagggcaaccttgccagtcaccgtacagtgcacacaggggaaaagccttaccactgctcaatctgcggagcccgttttaaccggccagcaaacctgaaaacgcacagccgcatccattcgggagagaagccgtataagtgtgagacgtgcggctcgcgctttgtacaggtggcacatctgcgggcgcacgtgctgatccacaccggggagaagccctacccttgccctacctgcggaacccgcttccgccacctgcagaccctcaagagccacgttcgcatccacaccggagagaagccttaccactgcgacccctgtggcctgcatttccggcacaagagtcaactgcggctgcatctgcgccagaaacacggagctgctaccaacaccaaagtgcactaccacattctcggggggccctag
Sequence Length
1443
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,531 Da
NCBI Official Full Name
Homo sapiens B-cell CLL/lymphoma 6, member B (zinc finger protein), mRNA
NCBI Official Synonym Full Names
B-cell CLL/lymphoma 6B
NCBI Official Symbol
BCL6B
NCBI Official Synonym Symbols
BAZF; ZNF62; ZBTB28
NCBI Protein Information
B-cell CLL/lymphoma 6 member B protein
UniProt Protein Name
B-cell CLL/lymphoma 6 member B protein
Protein Family
UniProt Gene Name
BCL6B
UniProt Synonym Gene Names
BAZF; ZNF62
UniProt Entry Name
BCL6B_HUMAN
Uniprot Description
BCL6B: Acts as a sequence-specific transcriptional repressor in association with BCL6. May function in a narrow stage or be related to some events in the early B-cell development.
Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor
Chromosomal Location of Human Ortholog: 17p13.1
Biological Process: myeloid cell differentiation; negative regulation of transcription from RNA polymerase II promoter; regulation of neurogenesis
Research Articles on BCL6B
Similar Products
Product Notes
The BCL6B bcl6b (Catalog #AAA1270014) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggttccc ccgccgcccc ggagggagcg ctgggctacg tccgcgagtt cactcgccac tcctccgacg tgctgggcaa cctcaacgag ctgcgcctgc gcgggatcct cactgacgtc acgctgctgg ttggcgggca acccctcaga gcacacaagg cagttctcat cgcctgcagt ggcttcttct attcaatttt ccggggccgt gcgggagtcg gggtggacgt gctctctctg cccgggggtc ccgaagcgag aggcttcgcc cctctattgg acttcatgta cacttcgcgc ctgcgcctct ctccagccac tgcaccagca gtcctagcgg ccgccaccta tttgcagatg gagcacgtgg tccaggcatg ccaccgcttc atccaggcca gctatgaacc tctgggcatc tccctgcgcc ccctggaagc agaaccccca acacccccaa cggcccctcc accaggtagt cccaggcgct ccgaaggaca cccagaccca cctactgaat ctcgaagctg cagtcaaggc ccccccagtc cagccagccc tgaccccaag gcctgcaact ggaaaaagta caagtacatc gtgctaaact ctcaggcctc ccaagcaggg agcctggtcg gggagagaag ttctggtcaa ccttgccccc aagccaggct ccccagtgga gacgaggcct ccagcagcag cagcagcagc agcagcagca gcagtgaaga aggacccatt cctggtcccc agagcaggct ctctccaact gctgccactg tgcagttcaa atgtggggct ccagccagta ccccctacct cctcacatcc caggctcaag acacctctgg atcaccctct gaacgggctc gtccactacc gggaagtgaa tttttcagct gccagaactc tgaggctgtg gcagggtgct catcggggct ggactccttg gttcctgggg acgaagacaa accctataag tgtcagctgt gccggtcttc gttccgctac aagggcaacc ttgccagtca ccgtacagtg cacacagggg aaaagcctta ccactgctca atctgcggag cccgttttaa ccggccagca aacctgaaaa cgcacagccg catccattcg ggagagaagc cgtataagtg tgagacgtgc ggctcgcgct ttgtacaggt ggcacatctg cgggcgcacg tgctgatcca caccggggag aagccctacc cttgccctac ctgcggaacc cgcttccgcc acctgcagac cctcaagagc cacgttcgca tccacaccgg agagaagcct taccactgcg acccctgtgg cctgcatttc cggcacaaga gtcaactgcg gctgcatctg cgccagaaac acggagctgc taccaacacc aaagtgcact accacattct cggggggccc tag. It is sometimes possible for the material contained within the vial of "BCL6B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
