SH3BGR cdna clone
SH3BGR cDNA Clone
Gene Names
SH3BGR; 21-GARP
Synonyms
SH3BGR; SH3BGR cDNA Clone; SH3BGR cdna clone
Sequence
atgcctctgctgctccttggagagacagagcctcttaagttggagcgggactgccggagcccagtggagccctgggctgctgccagccccgacctggcacttgcttgcctgtgtcactgtcaggatttgtctagcggcgcattccctaacaggggtgtgttggggggagtcctctttccaactgtcgaaatggttatcaaagtgtttgttgctacatcttctgggtccatagcgattaggaagaaacagcaagaagtagtgggttttttggaagcgaataaaatcgactttaaggaattagatattgctggagatgaagacaacaggaggtggatgagagagaatgttcctggagagaaaaaacctcaaaatgggattcctttgcctccccagatcttcaatgaggagcagtactgtggggattttgactctttcttctctgcaaaagaagagaatattatttattccttccttggtttggctcctcctccagactcaaagggatcagagaaggctgaagaaggtggagaaactgaggcacaaaaagagggcagtgaagatgtgggcaacctccctgaagcccaggagaagaatgaagaagaaggagagacagccacagaagagacggaagaaatagccatggagggtgcggaaggggaagccgaggaggaggaagaaactgcagaaggagaagagcctggagaagacgaagattcctag
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,976 Da
NCBI Official Full Name
Homo sapiens SH3 domain binding glutamic acid-rich protein, mRNA
NCBI Official Synonym Full Names
SH3 domain binding glutamate rich protein
NCBI Official Symbol
SH3BGR
NCBI Official Synonym Symbols
21-GARP
NCBI Protein Information
SH3 domain-binding glutamic acid-rich protein
UniProt Protein Name
SH3 domain-binding glutamic acid-rich protein
Protein Family
UniProt Gene Name
SH3BGR
UniProt Synonym Gene Names
SH3BGR protein; 21-GARP
UniProt Entry Name
SH3BG_HUMAN
Uniprot Description
SH3BGR: Belongs to the SH3BGR family.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 21q22.3
Cellular Component: cytosol
Molecular Function: SH3/SH2 adaptor activity
Biological Process: protein complex assembly
Research Articles on SH3BGR
Similar Products
Product Notes
The SH3BGR sh3bgr (Catalog #AAA1269870) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctctgc tgctccttgg agagacagag cctcttaagt tggagcggga ctgccggagc ccagtggagc cctgggctgc tgccagcccc gacctggcac ttgcttgcct gtgtcactgt caggatttgt ctagcggcgc attccctaac aggggtgtgt tggggggagt cctctttcca actgtcgaaa tggttatcaa agtgtttgtt gctacatctt ctgggtccat agcgattagg aagaaacagc aagaagtagt gggttttttg gaagcgaata aaatcgactt taaggaatta gatattgctg gagatgaaga caacaggagg tggatgagag agaatgttcc tggagagaaa aaacctcaaa atgggattcc tttgcctccc cagatcttca atgaggagca gtactgtggg gattttgact ctttcttctc tgcaaaagaa gagaatatta tttattcctt ccttggtttg gctcctcctc cagactcaaa gggatcagag aaggctgaag aaggtggaga aactgaggca caaaaagagg gcagtgaaga tgtgggcaac ctccctgaag cccaggagaa gaatgaagaa gaaggagaga cagccacaga agagacggaa gaaatagcca tggagggtgc ggaaggggaa gccgaggagg aggaagaaac tgcagaagga gaagagcctg gagaagacga agattcctag. It is sometimes possible for the material contained within the vial of "SH3BGR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
