Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETD8 cdna clone

SETD8 cDNA Clone

Gene Names
KMT5A; SET8; SET07; SETD8; PR-Set7
Synonyms
SETD8; SETD8 cDNA Clone; SETD8 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagaggcaggaagatgtccaagccccgcgcggtggaggcggcggcggcggcggcggcggtggcagcgacggccccgggcccggagatggtggagcggaggggcccggggaggccccgcaccgacggggagaacgtatttaccgggcagtcaaagatctattcctacatgagcccgaacaaatgctctggaatgcgtttcccccttcaggaagagaactcagttacacatcacgaagtcaaatgccaggggaaaccattagccggaatctacaggaaacgagaagagaaaagaaatgctgggaacgcagtacggagcgccatgaagtccgaggaacagaagatcaaagacgccaggaaaggtcccctggtaccttttccaaaccaaaaatctgaagcagcagaacctccaaaaactccaccctcatcttgtgattccaccaatgcagccatcgccaagcaagccctgaaaaagcccatcaagggcaaacaggccccccgaaaaaaagctcaaggaaaaacgcaacagaatcgcaaacttacggatttctaccctgtccgaaggagctccaggaagagcaaagccgagctgcagtctgaagaaaggaaaagaatagatgaattgattgaaagtgggaaggaagaaggaatgaagattgacctcatcgatggcaaaggcaggggtgtgattgccaccaagcagttctcccggggtgactttgtggtggaataccacggggacctcatcgagatcaccgacgccaagaaacgggaggctctgtacgcacaggacccttccacgggctgctacatgtactattttcagtatctgagcaaaacctactgcgtggatgcaactagagagacaaatcgcctaggaagactgatcaatcacagcaaatgtgggaactgccaaaccaaactgcacgacatcgacggcgtacgtcacctcatcctcatcgcctcccgagacatcgcggctggggaggagctcctgtatgactatggggaccgcagcaaggcttccattgaagcccacccgtggctgaagcattaa
Sequence Length
1059
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,223 Da
NCBI Official Full Name
Homo sapiens SET domain containing (lysine methyltransferase) 8, mRNA
NCBI Official Synonym Full Names
lysine methyltransferase 5A
NCBI Official Symbol
KMT5A
NCBI Official Synonym Symbols
SET8; SET07; SETD8; PR-Set7
NCBI Protein Information
N-lysine methyltransferase KMT5A
UniProt Protein Name
N-lysine methyltransferase KMT5A
UniProt Gene Name
KMT5A
UniProt Synonym Gene Names
PR-Set7; PR/SET07
UniProt Entry Name
KMT5A_HUMAN

NCBI Description

The protein encoded by this gene is a protein-lysine N-methyltransferase that can monomethylate Lys-20 of histone H4 to effect transcriptional repression of some genes. The encoded protein is required for cell proliferation and plays a role in chromatin condensation. [provided by RefSeq, May 2016]

Uniprot Description

SETD8: a protein-lysine N-methyltransferase that monomethylates both histones and non-histone proteins. Methylates K20 of histone H4 (H4K20me1), a specific tag for epigenetic transcriptional repression. SETD8 protein and H4K20me1 levels are cell cycle regulated, both increasing in S phase and peaking at G2/M phase. Interacts with the PCNA protein, associates with sites of active DNA synthesis and is required for DNA replication and genome stability during S phase. Inhibition of SET8 using shRNA results in arrest of replication forks, induction of double-stranded DNA breaks and a Chk1-mediated cell-cycle arrest in S and G2/M phases of the cell cycle. Mainly functions in euchromatin regions, thereby playing a central role in the silencing of euchromatic genes. Required for cell proliferation, probably by contributing to the maintenance of proper higher order structure of DNA during mitosis. Involved in chromosome condensation and proper cytokinesis. Inhibition of SET8 using shRNA results in arrest of replication forks, induction of double-stranded DNA breaks and a Chk1-mediated cell-cycle arrest in S and G2/M phases of the cell cycle. Nucleosomes are preferred as substrate compared to free histones. Methylates p53K382, leading to repression of the pro-apoptotic and checkpoint activation functions of p53. SET8 expression levels decrease in response to DNA damage, allowing p53 to activate checkpoints and/or apoptosis. Both the methylation of histone H4K20 and p53K382 appear to be important for the functions of SET8 in S phase. Belongs to the histone-lysine methyltransferase family. PR/SET subfamily. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Amino Acid Metabolism - lysine degradation; Methyltransferase, protein lysine; EC 2.1.1.43

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: histone lysine N-methyltransferase activity (H4-K20 specific); histone-lysine N-methyltransferase activity; lysine N-methyltransferase activity; p53 binding; protein binding; protein-lysine N-methyltransferase activity; transcription corepressor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; peptidyl-lysine mono-methylation; regulation of DNA damage response, signal transduction by p53 class mediator

Research Articles on SETD8

Similar Products

Product Notes

The SETD8 kmt5a (Catalog #AAA1269822) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagag gcaggaagat gtccaagccc cgcgcggtgg aggcggcggc ggcggcggcg gcggtggcag cgacggcccc gggcccggag atggtggagc ggaggggccc ggggaggccc cgcaccgacg gggagaacgt atttaccggg cagtcaaaga tctattccta catgagcccg aacaaatgct ctggaatgcg tttccccctt caggaagaga actcagttac acatcacgaa gtcaaatgcc aggggaaacc attagccgga atctacagga aacgagaaga gaaaagaaat gctgggaacg cagtacggag cgccatgaag tccgaggaac agaagatcaa agacgccagg aaaggtcccc tggtaccttt tccaaaccaa aaatctgaag cagcagaacc tccaaaaact ccaccctcat cttgtgattc caccaatgca gccatcgcca agcaagccct gaaaaagccc atcaagggca aacaggcccc ccgaaaaaaa gctcaaggaa aaacgcaaca gaatcgcaaa cttacggatt tctaccctgt ccgaaggagc tccaggaaga gcaaagccga gctgcagtct gaagaaagga aaagaataga tgaattgatt gaaagtggga aggaagaagg aatgaagatt gacctcatcg atggcaaagg caggggtgtg attgccacca agcagttctc ccggggtgac tttgtggtgg aataccacgg ggacctcatc gagatcaccg acgccaagaa acgggaggct ctgtacgcac aggacccttc cacgggctgc tacatgtact attttcagta tctgagcaaa acctactgcg tggatgcaac tagagagaca aatcgcctag gaagactgat caatcacagc aaatgtggga actgccaaac caaactgcac gacatcgacg gcgtacgtca cctcatcctc atcgcctccc gagacatcgc ggctggggag gagctcctgt atgactatgg ggaccgcagc aaggcttcca ttgaagccca cccgtggctg aagcattaa. It is sometimes possible for the material contained within the vial of "SETD8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.