Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR172A cdna clone

GPR172A cDNA Clone

Gene Names
SLC52A2; PAR1; RFT3; RFVT2; hRFT3; BVVLS2; GPCR41; GPR172A; D15Ertd747e
Synonyms
GPR172A; GPR172A cDNA Clone; GPR172A cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcacccacgcccgcccgtccggtgctgacccacctgctggtggctctcttcggcatgggctcctgggctgcggtcaatgggatctgggtggagctacctgtggtggtcaaagagcttccagagggttggagcctcccctcttacgtctctgtgcttgtggctctggggaacctgggtctgctggtggtgaccctctggaggaggctggccccaggaaaggacgagcaggtccccatccgggtggtgcaggtgctgggcatggtgggcacagccctgctggcctctctgtggcaccatgtggccccagtggcaggacagttgcattctgtggccttcttagcactggcctttgtgctggcactggcatgctgtgcctcgaatgtcactttcctgcccttcttgagccacctgccacctcgcttcttacggtcattcttcctgggtcaaggcctgagtgccctgctgccctgcgtgctggccctagtgcagggtgtgggccgcctcgagtgcccgccagcccccatcaacggcacccctggccccccgctcgacttccttgagcgttttcccgccagcaccttcttctgggcactgactgcccttctggtcgcttcagctgctgccttccagggtcttctgctgctgttgccgccaccaccatctgtacccacaggggagttaggatcaggcctccaggtgggagccccaggagcagaggaagaggtggaagagtcctcaccactgcaagagccaccaagccaggcagcaggcaccacccctggtccagaccctaaggcctatcagcttctatcagcccgcagtgcctgcctgctgggcctgttggccgccaccaacgcgctgaccaatggcgtgctgcctgccgtgcagagcttttcctgcttaccctacgggcgtctggcctaccacctggctgtggtgctgggcagtgctgccaatcccctggcctgcttcctggccatgggtgtgctgtgcaggtccttggcagggctgggcggcctctctctgctgggcgtgttctgtgggggctacctgatggcgctggcagtcctgagcccctgcccgcccctggtgggcacctcggcgggggtggtcctcgtggtgctgtcgtgggtgctgtgtcttggcgtgttctcctacgtgaaggtggcagccagctccctgctgcatggcgggggccggccggcattgctggcagccggcgtggccatccaggtgggctctctgctcggcgctgttgctatgttccccccgaccagcatctatcacgtgttccacagcagaaaggactgtgcagacccctgtgactcctga
Sequence Length
1338
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,777 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 172A, mRNA
NCBI Official Synonym Full Names
solute carrier family 52 member 2
NCBI Official Symbol
SLC52A2
NCBI Official Synonym Symbols
PAR1; RFT3; RFVT2; hRFT3; BVVLS2; GPCR41; GPR172A; D15Ertd747e
NCBI Protein Information
solute carrier family 52, riboflavin transporter, member 2
UniProt Protein Name
Solute carrier family 52, riboflavin transporter, member 2
UniProt Gene Name
SLC52A2
UniProt Synonym Gene Names
GPR172A; PAR1; RFT3; PERV-A receptor 1; hRFT3
UniProt Entry Name
S52A2_HUMAN

NCBI Description

This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012]

Uniprot Description

GPR172A: Riboflavin transporter. Riboflavin transport is Na(+)- independent but moderately pH-sensitive. Activity is strongly inhibited by riboflavin analogs, such as lumiflavin. Weakly inhibited by flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN). In case of infection by retroviruses, acts as a cell receptor to retroviral envelopes similar to the porcine endogenous retrovirus (PERV-A). Defects in SLC52A2 are the cause of Brown-Vialetto-Van Laere syndrome type 2 (BVVLS2). An autosomal recessive progressive neurologic disorder characterized by early childhood onset of sensorineural deafness, bulbar dysfunction, and severe diffuse muscle weakness and wasting resulting in respiratory insufficiency and loss of independent ambulation. Because it results from a defect in riboflavin metabolism, some patients may benefit from high-dose riboflavin supplementation. Belongs to the riboflavin transporter family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: integral to plasma membrane

Molecular Function: protein binding; riboflavin transporter activity

Biological Process: riboflavin transport

Disease: Brown-vialetto-van Laere Syndrome 2

Research Articles on GPR172A

Similar Products

Product Notes

The GPR172A slc52a2 (Catalog #AAA1269779) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcac ccacgcccgc ccgtccggtg ctgacccacc tgctggtggc tctcttcggc atgggctcct gggctgcggt caatgggatc tgggtggagc tacctgtggt ggtcaaagag cttccagagg gttggagcct cccctcttac gtctctgtgc ttgtggctct ggggaacctg ggtctgctgg tggtgaccct ctggaggagg ctggccccag gaaaggacga gcaggtcccc atccgggtgg tgcaggtgct gggcatggtg ggcacagccc tgctggcctc tctgtggcac catgtggccc cagtggcagg acagttgcat tctgtggcct tcttagcact ggcctttgtg ctggcactgg catgctgtgc ctcgaatgtc actttcctgc ccttcttgag ccacctgcca cctcgcttct tacggtcatt cttcctgggt caaggcctga gtgccctgct gccctgcgtg ctggccctag tgcagggtgt gggccgcctc gagtgcccgc cagcccccat caacggcacc cctggccccc cgctcgactt ccttgagcgt tttcccgcca gcaccttctt ctgggcactg actgcccttc tggtcgcttc agctgctgcc ttccagggtc ttctgctgct gttgccgcca ccaccatctg tacccacagg ggagttagga tcaggcctcc aggtgggagc cccaggagca gaggaagagg tggaagagtc ctcaccactg caagagccac caagccaggc agcaggcacc acccctggtc cagaccctaa ggcctatcag cttctatcag cccgcagtgc ctgcctgctg ggcctgttgg ccgccaccaa cgcgctgacc aatggcgtgc tgcctgccgt gcagagcttt tcctgcttac cctacgggcg tctggcctac cacctggctg tggtgctggg cagtgctgcc aatcccctgg cctgcttcct ggccatgggt gtgctgtgca ggtccttggc agggctgggc ggcctctctc tgctgggcgt gttctgtggg ggctacctga tggcgctggc agtcctgagc ccctgcccgc ccctggtggg cacctcggcg ggggtggtcc tcgtggtgct gtcgtgggtg ctgtgtcttg gcgtgttctc ctacgtgaag gtggcagcca gctccctgct gcatggcggg ggccggccgg cattgctggc agccggcgtg gccatccagg tgggctctct gctcggcgct gttgctatgt tccccccgac cagcatctat cacgtgttcc acagcagaaa ggactgtgca gacccctgtg actcctga. It is sometimes possible for the material contained within the vial of "GPR172A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.