Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP6V1D cdna clone

ATP6V1D cDNA Clone

Gene Names
ATP6V1D; VATD; VMA8; ATP6M
Synonyms
ATP6V1D; ATP6V1D cDNA Clone; ATP6V1D cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggcaaagaccgaattgaaatctttccctcgcgaatggcacagaccatcatgaaggctcgtttaaagggagcacagacaggtcgaaacctcctgaagaaaaaatctgatgccttaactcttcgatttcgacagatcctaaagaagataatagagactaaaatgttgatgggcgaagtgatgagagaagctgccttttcactagctgaagccatgttcacagcaggtgacttcagcactacagttatccaaaatgtcaataaagcgcaagtgaagattcgagcgaagaaagataatgtagcaggtgttactttgccagtatttgaacattaccatgaaggaactgacagttatgaactgactggtttagccagaggtggggaacagttggctaaattaaagaggaattatgccaaagcagtggaactactggtggaactagcttctctgcagacttcttttgttactttggatgaagctattaagataaccaacaggcgtgtaaatgccattgaacatgtcatcattccccggattgaacgtactcttgcttatatcatcacagagctggatgagagagagcgagaagagttctataggttaaagaaaatacaagagaagaaaaagattctaaaggaaaaatctgagaaggacttggagcaaaggagagcagctggagaggtgttggagcctgctaatcttctggctgaagagaaggacgaggatcttctatttgaataa
Sequence Length
744
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,263 Da
NCBI Official Full Name
Homo sapiens ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D, mRNA
NCBI Official Synonym Full Names
ATPase H+ transporting V1 subunit D
NCBI Official Symbol
ATP6V1D
NCBI Official Synonym Symbols
VATD; VMA8; ATP6M
NCBI Protein Information
V-type proton ATPase subunit D
UniProt Protein Name
V-type proton ATPase subunit D
UniProt Gene Name
ATP6V1D
UniProt Synonym Gene Names
ATP6M; VATD; V-ATPase subunit D
UniProt Entry Name
VATD_HUMAN

NCBI Description

This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes the V1 domain D subunit protein. [provided by RefSeq, Jul 2008]

Uniprot Description

ATP6V1D: Subunit of the peripheral V1 complex of vacuolar ATPase. Vacuolar ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells, thus providing most of the energy required for transport processes in the vacuolar system. Belongs to the V-ATPase D subunit family.

Protein type: EC 3.6.3.14; Energy Metabolism - oxidative phosphorylation; Hydrolase

Chromosomal Location of Human Ortholog: 14q23-q24.2

Cellular Component: centrosome; cilium; cytosol; lysosomal membrane; membrane

Molecular Function: protein binding

Biological Process: cilium biogenesis; insulin receptor signaling pathway; transferrin transport

Research Articles on ATP6V1D

Similar Products

Product Notes

The ATP6V1D atp6v1d (Catalog #AAA1269730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggca aagaccgaat tgaaatcttt ccctcgcgaa tggcacagac catcatgaag gctcgtttaa agggagcaca gacaggtcga aacctcctga agaaaaaatc tgatgcctta actcttcgat ttcgacagat cctaaagaag ataatagaga ctaaaatgtt gatgggcgaa gtgatgagag aagctgcctt ttcactagct gaagccatgt tcacagcagg tgacttcagc actacagtta tccaaaatgt caataaagcg caagtgaaga ttcgagcgaa gaaagataat gtagcaggtg ttactttgcc agtatttgaa cattaccatg aaggaactga cagttatgaa ctgactggtt tagccagagg tggggaacag ttggctaaat taaagaggaa ttatgccaaa gcagtggaac tactggtgga actagcttct ctgcagactt cttttgttac tttggatgaa gctattaaga taaccaacag gcgtgtaaat gccattgaac atgtcatcat tccccggatt gaacgtactc ttgcttatat catcacagag ctggatgaga gagagcgaga agagttctat aggttaaaga aaatacaaga gaagaaaaag attctaaagg aaaaatctga gaaggacttg gagcaaagga gagcagctgg agaggtgttg gagcctgcta atcttctggc tgaagagaag gacgaggatc ttctatttga ataa. It is sometimes possible for the material contained within the vial of "ATP6V1D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.