Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

GNPDA2 cdna clone

GNPDA2 cDNA Clone

Gene Names
GNPDA2; GNP2; SB52
Synonyms
GNPDA2; GNPDA2 cDNA Clone; GNPDA2 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgaggcttgtaattcttgataactatgacttggctagtgaatgggcagccaaatacatctgtaatcgcatcattcagttcaaacctggacaggacagatattttacactgggtttaccaacagggagtacacctttaggatgctataaaaaactaatagaatatcataagaatggacacctttcttttaaatatgtgaagacctttaatatggatgaatatgtaggacttccaagaaatcatcctgaaagctaccattcttatatgtggaataatttttttaagcatatcgatatagatcctaataatgcacatatccttgacgggaatgctgcagatttacaagcagaatgtgatgcttttgaaaacaaaataaaagaagctggaggaatagatctttttgttggaggaattggtccagatggtcatatcgctttcaatgagcctggatccagtttagtgtcaaggacaagattaaagactctagcaatggataccatcttggcaaatgccaaatattttgatggagatttatcaaaagtgtcaactatggctctaactgttggtgtggggacagtgatggatgctagagaagtaatgatccttataacaggggcacacaaggcatttgccctgtacaaagcaatagaaggagtcaatcacatgtggactgtttccgctttccagcagcatccccggactatttttgtatgcgatgaagatgctactttagaattaagagttaaaactgtgaaatactttaaaggtctaatgcatgtgcacaataaacttgtggatccactattcagtatgaaagatggaaactga
Sequence Length
828
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,091 Da
NCBI Official Full Name
Homo sapiens glucosamine-6-phosphate deaminase 2, mRNA
NCBI Official Synonym Full Names
glucosamine-6-phosphate deaminase 2
NCBI Official Symbol
GNPDA2
NCBI Official Synonym Symbols
GNP2; SB52
NCBI Protein Information
glucosamine-6-phosphate isomerase 2
UniProt Protein Name
Glucosamine-6-phosphate isomerase 2
UniProt Gene Name
GNPDA2
UniProt Synonym Gene Names
GNP2; GNPDA 2; GlcN6P deaminase 2
UniProt Entry Name
GNPI2_HUMAN

NCBI Description

The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Uniprot Description

GNPDA2: is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Protein type: EC 3.5.99.6; Isomerase; Hydrolase; Carbohydrate Metabolism - amino sugar and nucleotide sugar

Chromosomal Location of Human Ortholog: 4p12

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: glucosamine-6-phosphate deaminase activity; protein binding

Biological Process: glucose metabolic process; N-acetylglucosamine catabolic process; N-acetylneuraminate catabolic process; UDP-N-acetylglucosamine biosynthetic process

Research Articles on GNPDA2

Similar Products

Product Notes

The GNPDA2 gnpda2 (Catalog #AAA1269703) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcttg taattcttga taactatgac ttggctagtg aatgggcagc caaatacatc tgtaatcgca tcattcagtt caaacctgga caggacagat attttacact gggtttacca acagggagta cacctttagg atgctataaa aaactaatag aatatcataa gaatggacac ctttctttta aatatgtgaa gacctttaat atggatgaat atgtaggact tccaagaaat catcctgaaa gctaccattc ttatatgtgg aataattttt ttaagcatat cgatatagat cctaataatg cacatatcct tgacgggaat gctgcagatt tacaagcaga atgtgatgct tttgaaaaca aaataaaaga agctggagga atagatcttt ttgttggagg aattggtcca gatggtcata tcgctttcaa tgagcctgga tccagtttag tgtcaaggac aagattaaag actctagcaa tggataccat cttggcaaat gccaaatatt ttgatggaga tttatcaaaa gtgtcaacta tggctctaac tgttggtgtg gggacagtga tggatgctag agaagtaatg atccttataa caggggcaca caaggcattt gccctgtaca aagcaataga aggagtcaat cacatgtgga ctgtttccgc tttccagcag catccccgga ctatttttgt atgcgatgaa gatgctactt tagaattaag agttaaaact gtgaaatact ttaaaggtct aatgcatgtg cacaataaac ttgtggatcc actattcagt atgaaagatg gaaactga. It is sometimes possible for the material contained within the vial of "GNPDA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual