Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITPK1 cdna clone

ITPK1 cDNA Clone

Gene Names
ITPK1; ITRPK1
Synonyms
ITPK1; ITPK1 cDNA Clone; ITPK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagacctttctgaaagggaagagagttggctactggctgagcgagaagaaaatcaagaagctgaatttccaggccttcgccgagctgtgcaggaagcgagggatggaggttgtgcagctgaaccttagccggccgatcgaggagcagggccccctggacgtcatcatccacaagctgactgacgtcatccttgaagccgaccagaatgatagccagtccctggagctggtgcacaggttccaggagtacatcgatgcccaccctgagaccatcgtcctggacccgctccctgccatcagaaccctgcttgaccgctccaagtcctatgagctcatccggaagattgaggcctacatggaagacgacaggatctgctcgccacccttcatggagctcacgagcctgtgcggggatgacaccatgcggctgctggagaagaacggcttgactttcccattcatttgcaaaaccagagtggctcatggcaccaactctcacgagatggctatcgtgttcaaccaggagggcctgaacgccatccagccaccctgcgtggtccagaatttcatcaaccacaacgccgtcctgtacaaggtgttcgtggttggcgagtcctacaccgtggtccagaggccctcactcaagaacttctccgcaggcacatcagaccgtgagtccatcttcttcaacagccacaacgtgtcaaagccggagtcgtcatcggtcctgacggagctggacaagatcgagggcgtgttcgagcggccgagcgacgaggtcatccgggagctctcccgggccctgcggcaggcactgggcgtgtcactcttcggcatcgacatcatcatcaacaaccagacagggcagcacgccgtcattgacatcaatgccttcccaggggactgccaagtgtgctttatagaaggctggaagaccgactga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,632 Da
NCBI Official Full Name
Homo sapiens inositol 1,3,4-triphosphate 5/6 kinase, mRNA
NCBI Official Synonym Full Names
inositol-tetrakisphosphate 1-kinase
NCBI Official Symbol
ITPK1
NCBI Official Synonym Symbols
ITRPK1
NCBI Protein Information
inositol-tetrakisphosphate 1-kinase
UniProt Protein Name
Inositol-tetrakisphosphate 1-kinase
UniProt Gene Name
ITPK1
UniProt Synonym Gene Names
Inositol-triphosphate 5/6-kinase; Ins(1,3,4)P(3) 5/6-kinase
UniProt Entry Name
ITPK1_HUMAN

NCBI Description

This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]

Uniprot Description

ITPK1: Kinase that can phosphorylate various inositol polyphosphate such as Ins(3,4,5,6)P4 or Ins(1,3,4)P3. Phosphorylates Ins(3,4,5,6)P4 at position 1 to form Ins(1,3,4,5,6)P5. This reaction is thought to have regulatory importance, since Ins(3,4,5,6)P4 is an inhibitor of plasma membrane Ca(2+)-activated Cl(-) channels, while Ins(1,3,4,5,6)P5 is not. Also phosphorylates Ins(1,3,4)P3 on O-5 and O-6 to form Ins(1,3,4,6)P4, an essential molecule in the hexakisphosphate (InsP6) pathway. Also acts as an inositol polyphosphate phosphatase that dephosphorylate Ins(1,3,4,5)P4 and Ins(1,3,4,6)P4 to Ins(1,3,4)P3, and Ins(1,3,4,5,6)P5 to Ins(3,4,5,6)P4. May also act as an isomerase that interconverts the inositol tetrakisphosphate isomers Ins(1,3,4,5)P4 and Ins(1,3,4,6)P4 in the presence of ADP and magnesium. Probably acts as the rate-limiting enzyme of the InsP6 pathway. Modifies TNF-alpha-induced apoptosis by interfering with the activation of TNFRSF1A-associated death domain. Belongs to the ITPK1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, lipid; EC 2.7.1.134; Carbohydrate Metabolism - inositol phosphate; Motility/polarity/chemotaxis; EC 2.7.1.159

Chromosomal Location of Human Ortholog: 14q31

Cellular Component: cytosol

Molecular Function: catalytic activity; inositol tetrakisphosphate 1-kinase activity

Biological Process: blood coagulation; inositol phosphate metabolic process; signal transduction

Research Articles on ITPK1

Similar Products

Product Notes

The ITPK1 itpk1 (Catalog #AAA1269681) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagacct ttctgaaagg gaagagagtt ggctactggc tgagcgagaa gaaaatcaag aagctgaatt tccaggcctt cgccgagctg tgcaggaagc gagggatgga ggttgtgcag ctgaacctta gccggccgat cgaggagcag ggccccctgg acgtcatcat ccacaagctg actgacgtca tccttgaagc cgaccagaat gatagccagt ccctggagct ggtgcacagg ttccaggagt acatcgatgc ccaccctgag accatcgtcc tggacccgct ccctgccatc agaaccctgc ttgaccgctc caagtcctat gagctcatcc ggaagattga ggcctacatg gaagacgaca ggatctgctc gccacccttc atggagctca cgagcctgtg cggggatgac accatgcggc tgctggagaa gaacggcttg actttcccat tcatttgcaa aaccagagtg gctcatggca ccaactctca cgagatggct atcgtgttca accaggaggg cctgaacgcc atccagccac cctgcgtggt ccagaatttc atcaaccaca acgccgtcct gtacaaggtg ttcgtggttg gcgagtccta caccgtggtc cagaggccct cactcaagaa cttctccgca ggcacatcag accgtgagtc catcttcttc aacagccaca acgtgtcaaa gccggagtcg tcatcggtcc tgacggagct ggacaagatc gagggcgtgt tcgagcggcc gagcgacgag gtcatccggg agctctcccg ggccctgcgg caggcactgg gcgtgtcact cttcggcatc gacatcatca tcaacaacca gacagggcag cacgccgtca ttgacatcaa tgccttccca ggggactgcc aagtgtgctt tatagaaggc tggaagaccg actga. It is sometimes possible for the material contained within the vial of "ITPK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.