Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACADM cdna clone

ACADM cDNA Clone

Gene Names
ACADM; MCAD; ACAD1; MCADH
Synonyms
ACADM; ACADM cDNA Clone; ACADM cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcggggttcgggcgatgctgcagggtcctgagaagtatttctcgttttcattggagatcacagcatacaaaagccaatcgacaacgtgaaccaggattaggatttagttttgagttcaccgaacagcagaaagaatttcaagctactgctcgtaaatttgccagagaggaaatcatcccagtggctgcagaatatgataaaactggtgaatatccagtccccctaattagaagagcctgggaacttggtttaatgaacacacacattccagagaactgtggaggtcttggacttggaacttttgatgcttgtttaattagtgaagaattggcttatggatgtacaggggttcagactgctattgaaggaaattctttggggcaaatgcctattattattgctggaaatgatcaacaaaagaagaagtatttggggagaatgactgaggagccattgatgtgtgcttattgtgtaacagaacctggagcaggctctgatgtagctggtataaagaccaaagcagaaaagaaaggagatgagtatattattaatggtcagaagatgtggataaccaacggaggaaaagctaattggtattttttattggcacgttctgatccagatcctaaagctcctgctaataaagcctttactggattcattgtggaagcagataccccaggaattcagattgggagaaaggaattaaacatgggccagcgatgttcagatactagaggaattgtcttcgaagatgtgaaagtgcctaaagaaaatgttttaattggtgacggagctggtttcaaagttgcaatgggagcttttgataaaaccagacctgtagtagctgctggtgctgttggattagcacaaagagctttggatgaagctaccaagtatgccctggaaaggaaaactttcggaaagctacttgtagagcaccaagcaatatcatttatgctggctgaaatggcaatgaaagttgaactagctagaatgagttaccagagagcagcttgggaggttgattctggtcgtcgaaatacctattatgcttctattgcaaaggcatttgctggagatattgcaaatcagttagctactgatgctgtgcagatacttggaggcaatggatttaatacagaatatcctgtagaaaaactaatgagggatgccaaaatctatcagatttatgaaggtacttcacaaattcaaagacttattgtagcccgtgaacacattgacaagtacaaaaattaa
Sequence Length
1266
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
34
Molecular Weight
47,020 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase, C-4 to C-12 straight chain
NCBI Official Symbol
ACADM
NCBI Official Synonym Symbols
MCAD; ACAD1; MCADH
NCBI Protein Information
medium-chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Protein Name
Medium-chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Gene Name
ACADM
UniProt Synonym Gene Names
MCAD
UniProt Entry Name
ACADM_HUMAN

NCBI Description

This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ACADM: This enzyme is specific for acyl chain lengths of 4 to 16. Defects in ACADM are the cause of acyl-CoA dehydrogenase medium-chain deficiency (ACADMD). It is an autosomal recessive disease which causes fasting hypoglycemia, hepatic dysfunction, and encephalopathy, often resulting in death in infancy. Belongs to the acyl-CoA dehydrogenase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid Metabolism - fatty acid; Mitochondrial; EC 1.3.8.7; Other Amino Acids Metabolism - beta-alanine; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Carbohydrate Metabolism - propanoate; Oxidoreductase

Chromosomal Location of Human Ortholog: 1p31

Cellular Component: axon; mitochondrial matrix; mitochondrion; nucleus; peroxisome

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding; identical protein binding

Biological Process: carnitine biosynthetic process; carnitine metabolic process, CoA-linked; fatty acid beta-oxidation; fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis; medium-chain fatty acid catabolic process; medium-chain fatty acid metabolic process

Disease: Acyl-coa Dehydrogenase, Medium-chain, Deficiency Of

Research Articles on ACADM

Similar Products

Product Notes

The ACADM acadm (Catalog #AAA1269674) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgg ggttcgggcg atgctgcagg gtcctgagaa gtatttctcg ttttcattgg agatcacagc atacaaaagc caatcgacaa cgtgaaccag gattaggatt tagttttgag ttcaccgaac agcagaaaga atttcaagct actgctcgta aatttgccag agaggaaatc atcccagtgg ctgcagaata tgataaaact ggtgaatatc cagtccccct aattagaaga gcctgggaac ttggtttaat gaacacacac attccagaga actgtggagg tcttggactt ggaacttttg atgcttgttt aattagtgaa gaattggctt atggatgtac aggggttcag actgctattg aaggaaattc tttggggcaa atgcctatta ttattgctgg aaatgatcaa caaaagaaga agtatttggg gagaatgact gaggagccat tgatgtgtgc ttattgtgta acagaacctg gagcaggctc tgatgtagct ggtataaaga ccaaagcaga aaagaaagga gatgagtata ttattaatgg tcagaagatg tggataacca acggaggaaa agctaattgg tattttttat tggcacgttc tgatccagat cctaaagctc ctgctaataa agcctttact ggattcattg tggaagcaga taccccagga attcagattg ggagaaagga attaaacatg ggccagcgat gttcagatac tagaggaatt gtcttcgaag atgtgaaagt gcctaaagaa aatgttttaa ttggtgacgg agctggtttc aaagttgcaa tgggagcttt tgataaaacc agacctgtag tagctgctgg tgctgttgga ttagcacaaa gagctttgga tgaagctacc aagtatgccc tggaaaggaa aactttcgga aagctacttg tagagcacca agcaatatca tttatgctgg ctgaaatggc aatgaaagtt gaactagcta gaatgagtta ccagagagca gcttgggagg ttgattctgg tcgtcgaaat acctattatg cttctattgc aaaggcattt gctggagata ttgcaaatca gttagctact gatgctgtgc agatacttgg aggcaatgga tttaatacag aatatcctgt agaaaaacta atgagggatg ccaaaatcta tcagatttat gaaggtactt cacaaattca aagacttatt gtagcccgtg aacacattga caagtacaaa aattaa. It is sometimes possible for the material contained within the vial of "ACADM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.