Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SOX14 cdna clone

SOX14 cDNA Clone

Gene Names
SOX14; SOX28
Synonyms
SOX14; SOX14 cDNA Clone; SOX14 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTCCAAACCTTCAGACCACATCAAGCGGCCCATGAACGCCTTCATGGTATGGTCCCGGGGCCAGCGGCGCAAGATGGCCCAGGAAAACCCCAAGATGCACAACTCGGAGATCAGCAAACGCCTAGGTGCCGAATGGAAGCTTCTGTCCGAGGCAGAGAAGCGGCCATACATCGATGAAGCCAAGCGGCTACGCGCCCAGCACATGAAGGAGCACCCTGACTACAAGTACCGACCTCGGCGCAAGCCCAAGAACCTGCTCAAGAAGGACAGGTATGTCTTCCCCTTGCCCTACCTGGGCGACACGGACCCGCTCAAGGCGGCTGGCCTGCCCGTGGGGGCCTCTGACGGCCTCCTGAGCGCGCCCGAGAAAGCCCGGGCCTTCTTGCCGCCGGCCTCGGCGCCCTACTCCCTGCTGGACCCCGCGCAGTTTAGCTCGAGCGCCATCCAGAAGATGGGCGAAGTGCCCCACACCTTGGCTACCGGCGCTCTGCCCTACGCGTCCACCCTGGGCTACCAGAACGGCGCCTTCGGCAGCCTCAGCTGCCCCAGCCAGCACACGCACACGCACCCGTCCCCCACCAACCCTGGCTACGTGGTGCCCTGTAACTGTACCGCCTGGTCTGCCTCCACCCTGCAGCCCCCCGTCGCCTACATCCTCTTCCCAGGCATGACCAAGACTGGCATAGACCCTTATTCGTCAGCCCACGCTACGGCCATGTAA
Sequence Length
723
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,485 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 14, mRNA
NCBI Official Synonym Full Names
SRY-box 14
NCBI Official Symbol
SOX14
NCBI Official Synonym Symbols
SOX28
NCBI Protein Information
transcription factor SOX-14
UniProt Protein Name
Transcription factor SOX-14
Protein Family
UniProt Gene Name
SOX14
UniProt Synonym Gene Names
SOX28
UniProt Entry Name
SOX14_HUMAN

NCBI Description

This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene are suggested to be responsible for the limb defects associated with blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) and Mobius syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

SOX14: Acts as a negative regulator of transcription.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 3q22-q23

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; nervous system development

Research Articles on SOX14

Similar Products

Product Notes

The SOX14 sox14 (Catalog #AAA1269661) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTCCAAAC CTTCAGACCA CATCAAGCGG CCCATGAACG CCTTCATGGT ATGGTCCCGG GGCCAGCGGC GCAAGATGGC CCAGGAAAAC CCCAAGATGC ACAACTCGGA GATCAGCAAA CGCCTAGGTG CCGAATGGAA GCTTCTGTCC GAGGCAGAGA AGCGGCCATA CATCGATGAA GCCAAGCGGC TACGCGCCCA GCACATGAAG GAGCACCCTG ACTACAAGTA CCGACCTCGG CGCAAGCCCA AGAACCTGCT CAAGAAGGAC AGGTATGTCT TCCCCTTGCC CTACCTGGGC GACACGGACC CGCTCAAGGC GGCTGGCCTG CCCGTGGGGG CCTCTGACGG CCTCCTGAGC GCGCCCGAGA AAGCCCGGGC CTTCTTGCCG CCGGCCTCGG CGCCCTACTC CCTGCTGGAC CCCGCGCAGT TTAGCTCGAG CGCCATCCAG AAGATGGGCG AAGTGCCCCA CACCTTGGCT ACCGGCGCTC TGCCCTACGC GTCCACCCTG GGCTACCAGA ACGGCGCCTT CGGCAGCCTC AGCTGCCCCA GCCAGCACAC GCACACGCAC CCGTCCCCCA CCAACCCTGG CTACGTGGTG CCCTGTAACT GTACCGCCTG GTCTGCCTCC ACCCTGCAGC CCCCCGTCGC CTACATCCTC TTCCCAGGCA TGACCAAGAC TGGCATAGAC CCTTATTCGT CAGCCCACGC TACGGCCATG TAA. It is sometimes possible for the material contained within the vial of "SOX14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.