Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WNT9B cdna clone

WNT9B cDNA Clone

Gene Names
WNT9B; WNT15; WNT14B
Synonyms
WNT9B; WNT9B cDNA Clone; WNT9B cdna clone
Ordering
For Research Use Only!
Sequence
atgcgccccccgcccgcgctggccctggccgggctctgcctgctggcgctgcccgccgccgccgcctcctacttcggcctgaccgggcgggaagtcctgacgcccttcccaggattgggcactgcggcagccccggcacagggcggggcccacctgaagcagtgtgacctgctgaagctgtcccggcggcagaagcagctctgccggagggagcccggcctggctgagaccctgagggatgctgcgcacctcggcctgcttgagtgccagtttcagttccggcatgagcgctggaactgtagcctggagggcaggacgggcctgctcaagagaggcttcaaagagacagctttcctgtacgcggtgtcctctgccgccctcacccacaccctggcccgggcctgcagcgctgggcgcatggagcgctgcacctgtgatgactctccggggctggagagccggcaggcctggcagtggggcgtgtgcggtgacaacctcaagtacagcaccaagtttctgagcaacttcctggggtccaagagaggaaacaaggacctgcgggcacgggcagacgcccacaatacccacgtgggcatcaaggctgtgaagagtggcctcaggaccacgtgtaagtgccatggcgtatcaggctcctgtgccgtgcgcacctgctggaagcagctctccccgttccgtgagacgggccaggtgctgaaactgcgctatgactcggctgtcaaggtgtccagtgccaccaatgaggccttgggccgcctagagctgtgggcccctgccaggcagggcagcctcaccaaaggcctggccccaaggtctggggacctggtgtacatggaggactcacccagcttctgccggcccagcaagtactcacctggcacagcaggttggagtgcagtggcaagatctcagctcatcacaacctccacctcccggattcaagcgattctcccgtctcagctgcctgagtaa
Sequence Length
990
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,001 Da
NCBI Official Full Name
Homo sapiens wingless-type MMTV integration site family, member 9B, mRNA
NCBI Official Synonym Full Names
Wnt family member 9B
NCBI Official Symbol
WNT9B
NCBI Official Synonym Symbols
WNT15; WNT14B
NCBI Protein Information
protein Wnt-9b
UniProt Protein Name
Protein Wnt-9b
Protein Family
UniProt Gene Name
WNT9B
UniProt Synonym Gene Names
WNT14B; WNT15
UniProt Entry Name
WNT9B_HUMAN

NCBI Description

The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

WNT9B: Ligand for members of the frizzled family of seven transmembrane receptors. Probable developmental protein. May be a signaling molecule which affects the development of discrete regions of tissues. Is likely to signal over only few cell diameters. Belongs to the Wnt family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: extracellular region; extracellular space

Molecular Function: frizzled binding

Biological Process: cell fate commitment; neuron differentiation; Wnt receptor signaling pathway

Research Articles on WNT9B

Similar Products

Product Notes

The WNT9B wnt9b (Catalog #AAA1269639) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgccccc cgcccgcgct ggccctggcc gggctctgcc tgctggcgct gcccgccgcc gccgcctcct acttcggcct gaccgggcgg gaagtcctga cgcccttccc aggattgggc actgcggcag ccccggcaca gggcggggcc cacctgaagc agtgtgacct gctgaagctg tcccggcggc agaagcagct ctgccggagg gagcccggcc tggctgagac cctgagggat gctgcgcacc tcggcctgct tgagtgccag tttcagttcc ggcatgagcg ctggaactgt agcctggagg gcaggacggg cctgctcaag agaggcttca aagagacagc tttcctgtac gcggtgtcct ctgccgccct cacccacacc ctggcccggg cctgcagcgc tgggcgcatg gagcgctgca cctgtgatga ctctccgggg ctggagagcc ggcaggcctg gcagtggggc gtgtgcggtg acaacctcaa gtacagcacc aagtttctga gcaacttcct ggggtccaag agaggaaaca aggacctgcg ggcacgggca gacgcccaca atacccacgt gggcatcaag gctgtgaaga gtggcctcag gaccacgtgt aagtgccatg gcgtatcagg ctcctgtgcc gtgcgcacct gctggaagca gctctccccg ttccgtgaga cgggccaggt gctgaaactg cgctatgact cggctgtcaa ggtgtccagt gccaccaatg aggccttggg ccgcctagag ctgtgggccc ctgccaggca gggcagcctc accaaaggcc tggccccaag gtctggggac ctggtgtaca tggaggactc acccagcttc tgccggccca gcaagtactc acctggcaca gcaggttgga gtgcagtggc aagatctcag ctcatcacaa cctccacctc ccggattcaa gcgattctcc cgtctcagct gcctgagtaa. It is sometimes possible for the material contained within the vial of "WNT9B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.