PAK6 cdna clone
PAK6 cDNA Clone
Gene Names
PAK6; PAK5
Synonyms
PAK6; PAK6 cDNA Clone; PAK6 cdna clone
Sequence
atgttccgcaagaaaaagaagaaacgccctgagatctcagcgccacagaacttccagcaccgtgtccacacctccttcgaccccaaagaaggcaagtttgtgggcctccccccacaatggcagaacatcctggacacactgcggcgccccaagcccgtggtggacccttcgcgaatcacacgggtgcagctccagcccatgaagacagtggtgcggggcagcgcgatgcctgtggatggctacatctcggggctgctcaacgacatccagaagttgtcagtcatcagctccaacaccctgcgtggccgcagccccaccagccggcggcgggcacagtccctggggctgctgggggatgagcactgggccaccgacccagacatgtacctccagagcccccagtctgagcgcactgacccccacggcctctacctcagctgcaacgggggcacaccagcaggccacaagcagatgccgtggcccgagccacagagcccacgggtcctgcccaatgggctggctgcaaaggcacagtccctgggccccgccgagtttcagggtgcctcgcagcgctgtctgcagctgggtgcctgcctgcagagctccccaccaggagcctcgccccccacgggcaccaataggcatggaatgaaggctgccaagcatggctctgaggaggcccggccacagtcctgcctggtgggctcagccacaggcaggccaggtggggaaggcagccctagccctaagacccgggagagcagcctgaagcgcaggctattccgaagcatgttcctgtccactgctgccacagcccctccaagcagcagcaagccaggccctccaccacagagcaagcccaactcctctttccgaccgccgcagaaagacaaccccccaagcctggtggccaaggcccagtccttgccctcggaccagccggtggggaccttcagccctctgaccacttcggataccagcagcccccagaagtccctccgcacagccccggccacaggccagcttccaggccggtcttccccagcgggatccccccgcacctggcacgcccagatcagcaccagcaacctgtacctgccccaggaccccacggttgccaagggtgccctggctggtgaggacacaggtgttgtgacacatgagcagttcaaggctgcgctcaggatggtggtggaccagggtgacccccggctgctgctggacagctacgtgaagattggcgagggctccaccggcatcgtctgcttggcccgggagaagcactcgggccgccaggtggccgtcaagatgatggacctcaggaagcagcagcgcagggagctgctcttcaacgaggtggtgatcatgcgggactaccagcacttcaacgtggtggagatgtacaagagctacctggtgggcgaggagctgtgggtgctcatggagttcctgcagggaggagccctcacagacatcgtctcccaagtcaggctgaatgaggagcagattgccactgtgtgtgaggctgtgctgcaggccctggcctacctgcatgctcagggtgtcatccaccgggacatcaagagtgactccatcctgctgaccctcgatggcagggtgaagctctcggacttcggattctgtgctcagatcagcaaagacgtccctaagaggaagtccctggtgggaaccccctactggatggctcctgaagtgatctccaggtctttgtatgccactgaggtggatatctggtctctgggcatcatggtgattgagatggtagatggggagccaccgtacttcagtgactccccagtgcaagccatgaagaggctccgggacagccccccacccaagctgaaaaactctcacaaggtctccccagtgctgcgagacttcctggagcggatgctggtgcgggacccccaagagagagccacagcccaggagctcctagaccaccccttcctgctgcagacagggctacctgagtgcctggtgcccctgatccagctctaccgaaagcagacctccacctgctga
Sequence Length
2046
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,777 Da
NCBI Official Full Name
Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 6, mRNA
NCBI Official Synonym Full Names
p21 (RAC1) activated kinase 6
NCBI Official Symbol
PAK6
NCBI Official Synonym Symbols
PAK5
NCBI Protein Information
serine/threonine-protein kinase PAK 6
UniProt Protein Name
Serine/threonine-protein kinase PAK 6
Protein Family
UniProt Gene Name
PAK6
UniProt Synonym Gene Names
PAK5; PAK-6
UniProt Entry Name
PAK6_HUMAN
NCBI Description
This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Uniprot Description
PAK6: a protein kinase of the STE20 family. Interacts with androgen receptor (AR), and cotranslocates into the nucleus with AR in response to androgen. Highly expressed in testis and prostate tissues.
Protein type: EC 2.7.11.1; Protein kinase, STE; Protein kinase, Ser/Thr (non-receptor); Nuclear receptor co-regulator; Kinase, protein; STE group; STE20 family; PAKB subfamily
Chromosomal Location of Human Ortholog: 15q14
Cellular Component: cell-cell adherens junction; cytoplasm
Molecular Function: protein binding; receptor signaling protein serine/threonine kinase activity
Biological Process: apoptosis; cytoskeleton organization and biogenesis; mitotic cell cycle; regulation of transcription, DNA-dependent
Research Articles on PAK6
Similar Products
Product Notes
The PAK6 pak6 (Catalog #AAA1269516) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccgca agaaaaagaa gaaacgccct gagatctcag cgccacagaa cttccagcac cgtgtccaca cctccttcga ccccaaagaa ggcaagtttg tgggcctccc cccacaatgg cagaacatcc tggacacact gcggcgcccc aagcccgtgg tggacccttc gcgaatcaca cgggtgcagc tccagcccat gaagacagtg gtgcggggca gcgcgatgcc tgtggatggc tacatctcgg ggctgctcaa cgacatccag aagttgtcag tcatcagctc caacaccctg cgtggccgca gccccaccag ccggcggcgg gcacagtccc tggggctgct gggggatgag cactgggcca ccgacccaga catgtacctc cagagccccc agtctgagcg cactgacccc cacggcctct acctcagctg caacgggggc acaccagcag gccacaagca gatgccgtgg cccgagccac agagcccacg ggtcctgccc aatgggctgg ctgcaaaggc acagtccctg ggccccgccg agtttcaggg tgcctcgcag cgctgtctgc agctgggtgc ctgcctgcag agctccccac caggagcctc gccccccacg ggcaccaata ggcatggaat gaaggctgcc aagcatggct ctgaggaggc ccggccacag tcctgcctgg tgggctcagc cacaggcagg ccaggtgggg aaggcagccc tagccctaag acccgggaga gcagcctgaa gcgcaggcta ttccgaagca tgttcctgtc cactgctgcc acagcccctc caagcagcag caagccaggc cctccaccac agagcaagcc caactcctct ttccgaccgc cgcagaaaga caacccccca agcctggtgg ccaaggccca gtccttgccc tcggaccagc cggtggggac cttcagccct ctgaccactt cggataccag cagcccccag aagtccctcc gcacagcccc ggccacaggc cagcttccag gccggtcttc cccagcggga tccccccgca cctggcacgc ccagatcagc accagcaacc tgtacctgcc ccaggacccc acggttgcca agggtgccct ggctggtgag gacacaggtg ttgtgacaca tgagcagttc aaggctgcgc tcaggatggt ggtggaccag ggtgaccccc ggctgctgct ggacagctac gtgaagattg gcgagggctc caccggcatc gtctgcttgg cccgggagaa gcactcgggc cgccaggtgg ccgtcaagat gatggacctc aggaagcagc agcgcaggga gctgctcttc aacgaggtgg tgatcatgcg ggactaccag cacttcaacg tggtggagat gtacaagagc tacctggtgg gcgaggagct gtgggtgctc atggagttcc tgcagggagg agccctcaca gacatcgtct cccaagtcag gctgaatgag gagcagattg ccactgtgtg tgaggctgtg ctgcaggccc tggcctacct gcatgctcag ggtgtcatcc accgggacat caagagtgac tccatcctgc tgaccctcga tggcagggtg aagctctcgg acttcggatt ctgtgctcag atcagcaaag acgtccctaa gaggaagtcc ctggtgggaa ccccctactg gatggctcct gaagtgatct ccaggtcttt gtatgccact gaggtggata tctggtctct gggcatcatg gtgattgaga tggtagatgg ggagccaccg tacttcagtg actccccagt gcaagccatg aagaggctcc gggacagccc cccacccaag ctgaaaaact ctcacaaggt ctccccagtg ctgcgagact tcctggagcg gatgctggtg cgggaccccc aagagagagc cacagcccag gagctcctag accacccctt cctgctgcag acagggctac ctgagtgcct ggtgcccctg atccagctct accgaaagca gacctccacc tgctga. It is sometimes possible for the material contained within the vial of "PAK6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
