Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUMB cdna clone

NUMB cDNA Clone

Gene Names
NUMB; S171; C14orf41; c14_5527
Synonyms
NUMB; NUMB cDNA Clone; NUMB cdna clone
Ordering
For Research Use Only!
Sequence
atgccctatccagcccctaatgtgcctgtggtgggcatcactccctcccagatggtggccaacgtatttggcactgcaggccaccctcaggctgcccatccccatcagtcacccagcctggtcaggcagcagacattccctcactacgaggcaagcagtgctaccaccagtcccttctttaagcctcctgctcagcacctcaacggttctgcagctttcaatggtgtagatgatggcaggttggcctcagcagacaggcatacagaggttcctacaggcacctgcccagtggatccttttgaagcccagtgggctgcattagaaaataagtccaagcagcgtactaatccctcccctaccaaccctttctccagtgacttacagaagacgtttgaaattgaactttaa
Sequence Length
408
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,396 Da
NCBI Official Full Name
Homo sapiens numb homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
NUMB, endocytic adaptor protein
NCBI Official Symbol
NUMB
NCBI Official Synonym Symbols
S171; C14orf41; c14_5527
NCBI Protein Information
protein numb homolog
UniProt Protein Name
Protein numb homolog
Protein Family
UniProt Gene Name
NUMB
UniProt Synonym Gene Names
h-Numb
UniProt Entry Name
NUMB_HUMAN

NCBI Description

The protein encoded by this gene plays a role in the determination of cell fates during development. The encoded protein, whose degradation is induced in a proteasome-dependent manner by MDM2, is a membrane-bound protein that has been shown to associate with EPS15, LNX1, and NOTCH1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

NUMB: Plays a role in the process of neurogenesis. Required throughout embryonic neurogenesis to maintain neural progenitor cells, also called radial glial cells (RGCs), by allowing their daughter cells to choose progenitor over neuronal cell fate. Not required for the proliferation of neural progenitor cells before the onset of neurogenesis. Also involved postnatally in the subventricular zone (SVZ) neurogenesis by regulating SVZ neuroblasts survival and ependymal wall integrity. May also mediate local repair of brain ventricular wall damage. Interacts with CDH1 and TFAP2B. Interacts with EPS15, LNX and NOTCH1. May interact with DUOXA1. Interacts with RALBP1 in a complex also containing EPN1 and TFAP2A during interphase and mitosis. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell development/differentiation

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cell-cell adherens junction; clathrin-coated vesicle; focal adhesion; plasma membrane

Molecular Function: protein binding

Biological Process: lateral ventricle development; neuroblast division in the subventricular zone; positive regulation of cell migration; positive regulation of neurogenesis

Research Articles on NUMB

Similar Products

Product Notes

The NUMB numb (Catalog #AAA1269503) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctatc cagcccctaa tgtgcctgtg gtgggcatca ctccctccca gatggtggcc aacgtatttg gcactgcagg ccaccctcag gctgcccatc cccatcagtc acccagcctg gtcaggcagc agacattccc tcactacgag gcaagcagtg ctaccaccag tcccttcttt aagcctcctg ctcagcacct caacggttct gcagctttca atggtgtaga tgatggcagg ttggcctcag cagacaggca tacagaggtt cctacaggca cctgcccagt ggatcctttt gaagcccagt gggctgcatt agaaaataag tccaagcagc gtactaatcc ctcccctacc aaccctttct ccagtgactt acagaagacg tttgaaattg aactttaa. It is sometimes possible for the material contained within the vial of "NUMB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.