Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC5 cdna clone

XRCC5 cDNA Clone

Gene Names
XRCC5; KU80; KUB2; Ku86; NFIV; KARP1; KARP-1
Synonyms
XRCC5; XRCC5 cDNA Clone; XRCC5 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgcggtcggggaataaggcagctgttgtgctgtgtatggacgtgggctttaccatgagtaactccattcctggtatagaatccccatttgaacaagcaaagaaggtgataaccatgtttgtacagcgacaggtgtttgctgagaacaaggatgagattgctttagtcctgtttggtacagatggcactgacaatcccctttctggtggggatcagtatcagaacatcacagtgcacagacatctgatgctaccagattttgatttgctggaggacattgaaagcaaaatccaaccaggttctcaacaggctgacttcctggatgcactaatcgtgagcatggatgtgattcaacatgaaacaataggaaagaagtttgagaagaggcatattgaaatattcactgacctcagcagccgattcagcaaaagtcagctggatattataattcatagcttgaagaaatgtgacatctccctgcaattcttcttgcctttctcacttggcaaggaagatggaagtggggacagaggagatggcccctttcgcttaggtggccatgggccttcctttccactaaaaggaattaccgaacagcaaaaagaaggtcttgagatagtgaaaatggtgatgatatctttagaaggtgaagatgggttggatgaaatttattcattcagtgagagtctgagaaaactgtgcgtcttcaagaaaattgagaggcattccattcactggccctgccgactgaccattggctccaatttgtctataaggattgcagcctataaatcgattctacaggagagagttaaaaagacttggacagttgtggatgcaaaaaccctaaaaaaagaagatatacaaaaagaaacagtttattgcttaaatgatgatgatgaaactgaagttttaaaagaggatattattcaagggttccgctatggaagtgatatagttcctttctctaaagtggatgaggaacaaatgaaatataaatcggaggggaagtgcttctctgttttgggattttgtaaatcttctcaggttcagagaagattcttcatgggaaatcaagttctaaaggtctttgcagcaagagatgatgaggcagctgcagttgcactttcctccctgattcatgctttggatgacttagacatggtggccatagttcgatatgcttatgacaaaagagctaatcctcaagtcggcgtggcttttcctcatatcaagcataactatgagtgtttagtgtatgtgcagctgcctttcatggaagacttgcggcaatacatgttttcatccttgaaaaacagtaagaaatatgctcccaccgaggcacagttgaatgctgttgatgctttgattgactccatgagcttggcaaagaaagatgagaagacagacacccttgaagacttgtttccaaccaccaaaatcccaaatcctcgatttcagagattatttcagtgtctgctgcacagagctttacatccccgggagcctctacccccaattcagcagcatatttggaatatgctgaatcctcccgctgaggtgacaacgaaaagtcagattcctctctctaaaataaagaccctttttcctctgattgaagccaagaaaaaggatcaagtgactgctcaggaaattttccaagacaaccatgaagatggacctacagctaaaaaattaaagactgagcaagggggagcccacttcagcgtctccagtctggctgaaggcagtgtcacctctgttggaagtgtgaatcctgctgaaaacttccgtgttctagtgaaacagaagaaggccagctttgaggaagcgagtaaccagctcataaatcacatcgaacagtttttggatactaatgaaacaccgtattttatgaagagcatagactgcatccgagccttccgggaagaagccattaagttttcagaagagcagcgctttaacaacttcctgaaagcccttcaagagaaagtggaaattaaacaattaaatcatttctgggaaattgttgtccaggatggaattactctgatcaccaaagaggaagcctctggaagttctgtcacagctgaggaagccaaaaagtttctggcccccaaagacaaaccaagtggagacacagcagctgtatttgaagaaggtggtgatgtggacgatttattggacatgatatag
Sequence Length
2199
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
82,705 Da
NCBI Official Full Name
Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining), mRNA
NCBI Official Synonym Full Names
X-ray repair cross complementing 5
NCBI Official Symbol
XRCC5
NCBI Official Synonym Symbols
KU80; KUB2; Ku86; NFIV; KARP1; KARP-1
NCBI Protein Information
X-ray repair cross-complementing protein 5
UniProt Protein Name
X-ray repair cross-complementing protein 5
UniProt Gene Name
XRCC5
UniProt Synonym Gene Names
G22P2; CTC85; CTCBF; TLAA
UniProt Entry Name
XRCC5_HUMAN

NCBI Description

The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]

Uniprot Description

Ku80: the 80-kilodalton subunit of the Ku complex, also known as ATP-dependant DNA helicase II. A single stranded DNA-dependent ATP-dependent helicase. It functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Has a role in chromosome translocation. The DNA helicase II complex binds preferentially to fork-like ends of double-stranded DNA in a cell cycle-dependent manner. It works in the 3'-5' direction. Binding to DNA may be mediated by p70.

Protein type: RNA-binding; EC 3.6.1.-; EC 3.6.4.-; DNA-binding; Helicase; Nucleolus; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: cytosol; membrane; nuclear chromosome, telomeric region; nuclear telomere cap complex; nucleoplasm; nucleus; plasma membrane

Molecular Function: 5'-deoxyribose-5-phosphate lyase activity; damaged DNA binding; double-stranded DNA binding; double-stranded telomeric DNA binding; protein binding; protein C-terminus binding; telomeric DNA binding; ubiquitin protein ligase binding

Biological Process: double-strand break repair; double-strand break repair via nonhomologous end joining; negative regulation of transcription, DNA-dependent; positive regulation of interferon type I production; regulation of smooth muscle cell proliferation; telomere maintenance

Research Articles on XRCC5

Similar Products

Product Notes

The XRCC5 xrcc5 (Catalog #AAA1269493) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcggt cggggaataa ggcagctgtt gtgctgtgta tggacgtggg ctttaccatg agtaactcca ttcctggtat agaatcccca tttgaacaag caaagaaggt gataaccatg tttgtacagc gacaggtgtt tgctgagaac aaggatgaga ttgctttagt cctgtttggt acagatggca ctgacaatcc cctttctggt ggggatcagt atcagaacat cacagtgcac agacatctga tgctaccaga ttttgatttg ctggaggaca ttgaaagcaa aatccaacca ggttctcaac aggctgactt cctggatgca ctaatcgtga gcatggatgt gattcaacat gaaacaatag gaaagaagtt tgagaagagg catattgaaa tattcactga cctcagcagc cgattcagca aaagtcagct ggatattata attcatagct tgaagaaatg tgacatctcc ctgcaattct tcttgccttt ctcacttggc aaggaagatg gaagtgggga cagaggagat ggcccctttc gcttaggtgg ccatgggcct tcctttccac taaaaggaat taccgaacag caaaaagaag gtcttgagat agtgaaaatg gtgatgatat ctttagaagg tgaagatggg ttggatgaaa tttattcatt cagtgagagt ctgagaaaac tgtgcgtctt caagaaaatt gagaggcatt ccattcactg gccctgccga ctgaccattg gctccaattt gtctataagg attgcagcct ataaatcgat tctacaggag agagttaaaa agacttggac agttgtggat gcaaaaaccc taaaaaaaga agatatacaa aaagaaacag tttattgctt aaatgatgat gatgaaactg aagttttaaa agaggatatt attcaagggt tccgctatgg aagtgatata gttcctttct ctaaagtgga tgaggaacaa atgaaatata aatcggaggg gaagtgcttc tctgttttgg gattttgtaa atcttctcag gttcagagaa gattcttcat gggaaatcaa gttctaaagg tctttgcagc aagagatgat gaggcagctg cagttgcact ttcctccctg attcatgctt tggatgactt agacatggtg gccatagttc gatatgctta tgacaaaaga gctaatcctc aagtcggcgt ggcttttcct catatcaagc ataactatga gtgtttagtg tatgtgcagc tgcctttcat ggaagacttg cggcaataca tgttttcatc cttgaaaaac agtaagaaat atgctcccac cgaggcacag ttgaatgctg ttgatgcttt gattgactcc atgagcttgg caaagaaaga tgagaagaca gacacccttg aagacttgtt tccaaccacc aaaatcccaa atcctcgatt tcagagatta tttcagtgtc tgctgcacag agctttacat ccccgggagc ctctaccccc aattcagcag catatttgga atatgctgaa tcctcccgct gaggtgacaa cgaaaagtca gattcctctc tctaaaataa agaccctttt tcctctgatt gaagccaaga aaaaggatca agtgactgct caggaaattt tccaagacaa ccatgaagat ggacctacag ctaaaaaatt aaagactgag caagggggag cccacttcag cgtctccagt ctggctgaag gcagtgtcac ctctgttgga agtgtgaatc ctgctgaaaa cttccgtgtt ctagtgaaac agaagaaggc cagctttgag gaagcgagta accagctcat aaatcacatc gaacagtttt tggatactaa tgaaacaccg tattttatga agagcataga ctgcatccga gccttccggg aagaagccat taagttttca gaagagcagc gctttaacaa cttcctgaaa gcccttcaag agaaagtgga aattaaacaa ttaaatcatt tctgggaaat tgttgtccag gatggaatta ctctgatcac caaagaggaa gcctctggaa gttctgtcac agctgaggaa gccaaaaagt ttctggcccc caaagacaaa ccaagtggag acacagcagc tgtatttgaa gaaggtggtg atgtggacga tttattggac atgatatag. It is sometimes possible for the material contained within the vial of "XRCC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.