WDR92 cdna clone
WDR92 cDNA Clone
Synonyms
WDR92; WDR92 cDNA Clone; WDR92 cdna clone
Sequence
atgtcggccttcgagaagcctcagatcatcgcccatatccagaagggcttcaactacacggtgtttgactgtaagtgggtgccctgcagcgccaaatttgtgaccatgggcaacttcgcacggggcaccggcgtcattcagctgtacgagatccagcacggggacctgaagctgcttcgggagattgaaaaggccaaacctattaaatgtggaacatttggtgcaacatctttacagcagagatatttagctactggagattttggtggaaaccttcatatatggaatttagaagctccagagatgccagtatattctgtaaagggccataaagaaattataaatgccatagatggcataggtggactaggaattggagaaggagcacctgaaattgtgactggcagccgagatggaactgtgaaggtgtgggacccaaggcaaaaagatgatcctgttgctaatatggaacctgtacaaggagaaaacaagagagactgttggactgtggcatttggcaatgcttataatcaagaagaacgtgttgtttgtgctggctatgacaatggggatatcaaactatttgatctcagaaatatggcattacggtgggagacaaacatcaaaaatggggtgtgtagcttggagtttgacagaaaagacataagtatgaataagttagtagccacatctctggaaggaaagttccatgtttttgacatgagaacacagcatccaaccaaaggttttgcctctgtttcagaaaaggctcataaatctactgtgtggcaggtccgacacctgccgcagaacagggagctctttctgacagctggaggcgccggcggccttcacctctggaagtag
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,128 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 92, mRNA
NCBI Official Synonym Full Names
WD repeat domain 92
NCBI Official Symbol
WDR92
NCBI Protein Information
WD repeat-containing protein 92
UniProt Protein Name
WD repeat-containing protein 92
Protein Family
UniProt Gene Name
WDR92
UniProt Entry Name
WDR92_HUMAN
NCBI Description
This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Uniprot Description
WDR92: Seems to act as a modulator of apoptosis.
Protein type: Apoptosis
Chromosomal Location of Human Ortholog: 2p14
Molecular Function: protein binding; ubiquitin binding
Research Articles on WDR92
Similar Products
Product Notes
The WDR92 wdr92 (Catalog #AAA1269465) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggcct tcgagaagcc tcagatcatc gcccatatcc agaagggctt caactacacg gtgtttgact gtaagtgggt gccctgcagc gccaaatttg tgaccatggg caacttcgca cggggcaccg gcgtcattca gctgtacgag atccagcacg gggacctgaa gctgcttcgg gagattgaaa aggccaaacc tattaaatgt ggaacatttg gtgcaacatc tttacagcag agatatttag ctactggaga ttttggtgga aaccttcata tatggaattt agaagctcca gagatgccag tatattctgt aaagggccat aaagaaatta taaatgccat agatggcata ggtggactag gaattggaga aggagcacct gaaattgtga ctggcagccg agatggaact gtgaaggtgt gggacccaag gcaaaaagat gatcctgttg ctaatatgga acctgtacaa ggagaaaaca agagagactg ttggactgtg gcatttggca atgcttataa tcaagaagaa cgtgttgttt gtgctggcta tgacaatggg gatatcaaac tatttgatct cagaaatatg gcattacggt gggagacaaa catcaaaaat ggggtgtgta gcttggagtt tgacagaaaa gacataagta tgaataagtt agtagccaca tctctggaag gaaagttcca tgtttttgac atgagaacac agcatccaac caaaggtttt gcctctgttt cagaaaaggc tcataaatct actgtgtggc aggtccgaca cctgccgcag aacagggagc tctttctgac agctggaggc gccggcggcc ttcacctctg gaagtag. It is sometimes possible for the material contained within the vial of "WDR92, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
