Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHOD cdna clone

RHOD cDNA Clone

Gene Names
RHOD; Rho; ARHD; RHOM; RHOHP1
Synonyms
RHOD; RHOD cDNA Clone; RHOD cdna clone
Ordering
For Research Use Only!
Sequence
atgacggcggcccaggccgcgggtgaggaggcgccaccaggcgtgcggtccgtcaaggtggtcctggtgggcgacggcggctgcgggaagacgtcgctgctgatggtcttcgccgatggggccttccccgagagctacacccccacggtgtttgagcggtacatggtcaacctgcaagtgaaaggcaaacctgtgcacctccacatctgggacacagcagggcaagatgactatgaccgcctgcggcccctgttctaccctgacgccagcgtcctgctgctttgcttcgatgtcaccagcccgaacagctttgacaacatctttaaccggtggtacccagaagtgaatcatttctgcaagaaggtacccatcatcgtcgtgggctgcaagactgacctgcgcaaggacaaatcactggtgaacaagctccgaagaaacggattggagcctgtgacctaccacaggggccaggagatggcgaggtccgtgggcgcggtggcctacctcgagtgctcggctcggctccatgacaacgtccacgccgtcttccaggaggccgccgaggtggccctcagcagccgcggtcgcaacttctggcggcggattacccagggcttttgcgtggtgacctga
Sequence Length
633
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,413 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member D, mRNA
NCBI Official Synonym Full Names
ras homolog family member D
NCBI Official Symbol
RHOD
NCBI Official Synonym Symbols
Rho; ARHD; RHOM; RHOHP1
NCBI Protein Information
rho-related GTP-binding protein RhoD
UniProt Protein Name
Rho-related GTP-binding protein RhoD
Protein Family
UniProt Gene Name
RHOD
UniProt Synonym Gene Names
ARHD; RhoHP1
UniProt Entry Name
RHOD_HUMAN

NCBI Description

Ras homolog, or Rho, proteins interact with protein kinases and may serve as targets for activated GTPase. They play a critical role in muscle differentiation. The protein encoded by this gene binds GTP and is a member of the small GTPase superfamily. It is involved in endosome dynamics and reorganization of the actin cytoskeleton, and it may coordinate membrane transport with the function of the cytoskeleton. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

RHOD: Involved in endosome dynamics. May coordinate membrane transport with the function of the cytoskeleton. Participates in reorganization of actin cytoskeleton. Belongs to the small GTPase superfamily. Rho family.

Protein type: G protein; Motility/polarity/chemotaxis; G protein, monomeric, Rho; G protein, monomeric

Chromosomal Location of Human Ortholog: 11q14.3

Cellular Component: cytosol; endosome membrane; plasma membrane

Molecular Function: GTPase activity

Biological Process: actin filament bundle formation; focal adhesion formation; lamellipodium biogenesis; positive regulation of cell adhesion; positive regulation of cell migration; regulation of small GTPase mediated signal transduction; Rho protein signal transduction

Research Articles on RHOD

Similar Products

Product Notes

The RHOD rhod (Catalog #AAA1269452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggcgg cccaggccgc gggtgaggag gcgccaccag gcgtgcggtc cgtcaaggtg gtcctggtgg gcgacggcgg ctgcgggaag acgtcgctgc tgatggtctt cgccgatggg gccttccccg agagctacac ccccacggtg tttgagcggt acatggtcaa cctgcaagtg aaaggcaaac ctgtgcacct ccacatctgg gacacagcag ggcaagatga ctatgaccgc ctgcggcccc tgttctaccc tgacgccagc gtcctgctgc tttgcttcga tgtcaccagc ccgaacagct ttgacaacat ctttaaccgg tggtacccag aagtgaatca tttctgcaag aaggtaccca tcatcgtcgt gggctgcaag actgacctgc gcaaggacaa atcactggtg aacaagctcc gaagaaacgg attggagcct gtgacctacc acaggggcca ggagatggcg aggtccgtgg gcgcggtggc ctacctcgag tgctcggctc ggctccatga caacgtccac gccgtcttcc aggaggccgc cgaggtggcc ctcagcagcc gcggtcgcaa cttctggcgg cggattaccc agggcttttg cgtggtgacc tga. It is sometimes possible for the material contained within the vial of "RHOD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.