Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXXC1 cdna clone

CXXC1 cDNA Clone

Gene Names
CXXC1; CFP1; CGBP; SPP1; PCCX1; PHF18; hCGBP; ZCGPC1; HsT2645; 2410002I16Rik; 5830420C16Rik
Synonyms
CXXC1; CXXC1 cDNA Clone; CXXC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagggagatggttcagacccagagcctccagatgccggggaggacagcaagtccgagaatggggagaatgcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcgggtgtgacaactgcaatgagtggttccatggggactgcatccggatcactgagaagatggccaaggccatccgggagtggtactgtcgggagtgcagagagaaagaccccaagctagagattcgctatcggcacaagaaatcacgggagcgggatggcaatgagcgggacagcagtgagccccgggatgagggtggagggcgcaagaggcctgtccctgatccagacctgcagcgccgggcagggtcagggacaggggttggggccatgcttgctcggggctctgcttcgccccacaaatcctctccgcagcccttggtggccacacccagccagcatcaccagcagcagcagcagcagatcaaacggtcagcccgcatgtgtggtgagtgtgaggcatgtcggcgcactgaggactgtggtcactgtgatttctgtcgggacatgaagaagttcgggggccccaacaagatccggcagaagtgccggctgcgccagtgccagctgcgggcccgggaatcgtacaagtacttcccttcctcgctctcaccagtgacgccctcagagtccctgccaaggccccgccggccactgcccacccaacagcagccacagccatcacagaagttagggcgcatccgtgaagatgagggggcagtggcgtcatcaacagtcaaggagcctcctgaggctacagccacacctgagccactctcagatgaggacctacctctggatcctgacctgtatcaggacttctgtgcaggggcctttgatgaccatggcctgccctggatgagcgacacagaagagtccccattcctggaccccgcgctgcggaagagggcagtgaaagtgaagcatgtgaagcgtcgggagaagaagtctgagaagaaggtgatggagaggaaggaggagcgatacaagcggcatcggcagaagcagaagcacaaggataaatggaaacacccagagagggctgatgccaaggaccctgcgtcactgccccagtgcctggggcccggctgtgtgcgccccgcccagcccagctccaagtattgctcagatgactgtggcatgaagctggcagccaaccgcatctacgagatcctcccccagcgcatccagcagtggcagcagagcccttgcattgctgaagagcacggcaagaagctgctcgaacgcattcgccgagagcagcagagtgcccgcacccgccttcaggaaatggaacgccgattccatgagcttgaggccatcattctacgtgccaagcagcaggctgtgcgcgaggatgaggagagcaacgagggtgacagtgatgacacagacctgcagatcttctgtgtttcctgtgggcaccccatcaacccacgtgttgccttgcgccacatggagcgctgctacgccaagtatgagagccagacgtcctttgggtccatgtaccccacacgcattgaaggggccacacgactcttctgtgatgtgtataatcctcagagcaaaacatactgtaagcggctccaggtgctgtgccccgagcactcacgggaccccaaagtgccagctgacgaggtatgcgggtgcccccttgtacgtgatgtctttgagctcacgggtgacttctgccgcctgcccaagcgccagtgcaatcgccattactgctgggagaagctgcggcgtgcggaagtggacttggagcgcgtgcgtgtgtggtacaagctggacgagctgtttgagcaggagcgcaatgtgcgcacagccatgacaaaccgcgcgggattgctggccctgatgctgcaccagacgatccagcacgatcccctcactaccgacctgcgctccagtgccgaccgctga
Sequence Length
1983
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,227 Da
NCBI Official Full Name
Homo sapiens CXXC finger 1 (PHD domain), mRNA
NCBI Official Synonym Full Names
CXXC finger protein 1
NCBI Official Symbol
CXXC1
NCBI Official Synonym Symbols
CFP1; CGBP; SPP1; PCCX1; PHF18; hCGBP; ZCGPC1; HsT2645; 2410002I16Rik; 5830420C16Rik
NCBI Protein Information
CXXC-type zinc finger protein 1
UniProt Protein Name
CXXC-type zinc finger protein 1
UniProt Gene Name
CXXC1
UniProt Synonym Gene Names
CFP1; CGBP; PCCX1; PHF18
UniProt Entry Name
CXXC1_HUMAN

NCBI Description

This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]

Uniprot Description

CXXC1: Transcriptional activator that exhibits a unique DNA binding specificity for CpG unmethylated motifs with a preference for CpGG. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 18q12

Cellular Component: cytoplasm; histone methyltransferase complex; nuclear speck; nucleoplasm; nucleus

Molecular Function: histone lysine N-methyltransferase activity (H3-K4 specific); protein binding; unmethylated CpG binding

Biological Process: histone H3-K4 methylation; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent

Research Articles on CXXC1

Similar Products

Product Notes

The CXXC1 cxxc1 (Catalog #AAA1269370) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggag atggttcaga cccagagcct ccagatgccg gggaggacag caagtccgag aatggggaga atgcgcccat ctactgcatc tgccgcaaac cggacatcaa ctgcttcatg atcgggtgtg acaactgcaa tgagtggttc catggggact gcatccggat cactgagaag atggccaagg ccatccggga gtggtactgt cgggagtgca gagagaaaga ccccaagcta gagattcgct atcggcacaa gaaatcacgg gagcgggatg gcaatgagcg ggacagcagt gagccccggg atgagggtgg agggcgcaag aggcctgtcc ctgatccaga cctgcagcgc cgggcagggt cagggacagg ggttggggcc atgcttgctc ggggctctgc ttcgccccac aaatcctctc cgcagccctt ggtggccaca cccagccagc atcaccagca gcagcagcag cagatcaaac ggtcagcccg catgtgtggt gagtgtgagg catgtcggcg cactgaggac tgtggtcact gtgatttctg tcgggacatg aagaagttcg ggggccccaa caagatccgg cagaagtgcc ggctgcgcca gtgccagctg cgggcccggg aatcgtacaa gtacttccct tcctcgctct caccagtgac gccctcagag tccctgccaa ggccccgccg gccactgccc acccaacagc agccacagcc atcacagaag ttagggcgca tccgtgaaga tgagggggca gtggcgtcat caacagtcaa ggagcctcct gaggctacag ccacacctga gccactctca gatgaggacc tacctctgga tcctgacctg tatcaggact tctgtgcagg ggcctttgat gaccatggcc tgccctggat gagcgacaca gaagagtccc cattcctgga ccccgcgctg cggaagaggg cagtgaaagt gaagcatgtg aagcgtcggg agaagaagtc tgagaagaag gtgatggaga ggaaggagga gcgatacaag cggcatcggc agaagcagaa gcacaaggat aaatggaaac acccagagag ggctgatgcc aaggaccctg cgtcactgcc ccagtgcctg gggcccggct gtgtgcgccc cgcccagccc agctccaagt attgctcaga tgactgtggc atgaagctgg cagccaaccg catctacgag atcctccccc agcgcatcca gcagtggcag cagagccctt gcattgctga agagcacggc aagaagctgc tcgaacgcat tcgccgagag cagcagagtg cccgcacccg ccttcaggaa atggaacgcc gattccatga gcttgaggcc atcattctac gtgccaagca gcaggctgtg cgcgaggatg aggagagcaa cgagggtgac agtgatgaca cagacctgca gatcttctgt gtttcctgtg ggcaccccat caacccacgt gttgccttgc gccacatgga gcgctgctac gccaagtatg agagccagac gtcctttggg tccatgtacc ccacacgcat tgaaggggcc acacgactct tctgtgatgt gtataatcct cagagcaaaa catactgtaa gcggctccag gtgctgtgcc ccgagcactc acgggacccc aaagtgccag ctgacgaggt atgcgggtgc ccccttgtac gtgatgtctt tgagctcacg ggtgacttct gccgcctgcc caagcgccag tgcaatcgcc attactgctg ggagaagctg cggcgtgcgg aagtggactt ggagcgcgtg cgtgtgtggt acaagctgga cgagctgttt gagcaggagc gcaatgtgcg cacagccatg acaaaccgcg cgggattgct ggccctgatg ctgcaccaga cgatccagca cgatcccctc actaccgacc tgcgctccag tgccgaccgc tga. It is sometimes possible for the material contained within the vial of "CXXC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.