Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBPMS cdna clone

RBPMS cDNA Clone

Gene Names
RBPMS; HERMES
Synonyms
RBPMS; RBPMS cDNA Clone; RBPMS cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaacggcggcaaagccgagaaggagaacaccccgagcgaggccaaccttcaggaggaggaggtccggaccctatttgtcagtggccttcctctggatatcaaacctcgggagctctatctgcttttcagaccatttaagggctatgagggttctcttataaagctcacatctaaacagcctgtaggttttgtcagttttgacagtcgctcagaagcagaggctgcaaagaatgctttgaatggcatccgcttcgatcctgaaattccgcaaacactacgactagagtttgctaaggcaaacacgaagatggccaagaacaaactcgtagggactccaaaccccagtactcctctgcccaacactgtacctcagttcattgccagagagccatatgagctcacagtgcctgcactttaccccagtagccctgaagtgtgggccccgtaccctctgtacccagcggagttagcgcctgctctacctcctcctgctttcacctatcccgcttcactgcatgcccagtgtttctctcctgaggcaaagcccaacacacctgtcttttgtccacttctccagcaaattagatttgtctctgggaatgtgtttgtaacataccaacctactgcagaccagcagagggagctcccatgttga
Sequence Length
660
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,022 Da
NCBI Official Full Name
Homo sapiens RNA binding protein with multiple splicing, mRNA
NCBI Official Synonym Full Names
RNA binding protein with multiple splicing
NCBI Official Symbol
RBPMS
NCBI Official Synonym Symbols
HERMES
NCBI Protein Information
RNA-binding protein with multiple splicing
UniProt Protein Name
RNA-binding protein with multiple splicing
UniProt Gene Name
RBPMS
UniProt Synonym Gene Names
HERMES; RBP-MS; Hermes
UniProt Entry Name
RBPMS_HUMAN

NCBI Description

This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]

Uniprot Description

RBPMS: Acts as a coactivator of transcriptional activity. Required to increase TGFB1/Smad-mediated transactivation. Acts through SMAD2, SMAD3 and SMAD4 to increase transcriptional activity. Increases phosphorylation of SMAD2 and SMAD3 on their C- terminal SSXS motif, possibly through recruitment of TGFBR1. Promotes the nuclear accumulation of SMAD2, SMAD3 and SMAD4 proteins. Binds to poly(A) RNA. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 8p12

Cellular Component: cytoplasm; nucleoplasm; stress granule

Molecular Function: poly(A) binding; protein binding; protein homodimerization activity; RNA binding; transcription coactivator activity

Biological Process: response to oxidative stress; RNA processing

Research Articles on RBPMS

Similar Products

Product Notes

The RBPMS rbpms (Catalog #AAA1269364) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaacg gcggcaaagc cgagaaggag aacaccccga gcgaggccaa ccttcaggag gaggaggtcc ggaccctatt tgtcagtggc cttcctctgg atatcaaacc tcgggagctc tatctgcttt tcagaccatt taagggctat gagggttctc ttataaagct cacatctaaa cagcctgtag gttttgtcag ttttgacagt cgctcagaag cagaggctgc aaagaatgct ttgaatggca tccgcttcga tcctgaaatt ccgcaaacac tacgactaga gtttgctaag gcaaacacga agatggccaa gaacaaactc gtagggactc caaaccccag tactcctctg cccaacactg tacctcagtt cattgccaga gagccatatg agctcacagt gcctgcactt taccccagta gccctgaagt gtgggccccg taccctctgt acccagcgga gttagcgcct gctctacctc ctcctgcttt cacctatccc gcttcactgc atgcccagtg tttctctcct gaggcaaagc ccaacacacc tgtcttttgt ccacttctcc agcaaattag atttgtctct gggaatgtgt ttgtaacata ccaacctact gcagaccagc agagggagct cccatgttga. It is sometimes possible for the material contained within the vial of "RBPMS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.