Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP2K6 cdna clone

MAP2K6 cDNA Clone

Gene Names
MAP2K6; MEK6; MKK6; MAPKK6; PRKMK6; SAPKK3; SAPKK-3
Synonyms
MAP2K6; MAP2K6 cDNA Clone; MAP2K6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcagtcgaaaggcaagaagcgaaaccctggccttaaaattccaaaagaagcatttgaacaacctcagaccagttccacaccacctcgagatttagactccaaggcttgcatttctattggaaatcagaactttgaggtgaaggcagatgacctggagcctataatggaactgggacgaggtgcgtacggggtggtggagaagatgcggcacgtgcccagcgggcagatcatggcagtgaagcggatccgagccacagtaaatagccaggaacagaaacggctactgatggatttggatatttccatgaggacggtggactgtccattcactgtcaccttttatggcgcactgtttcgggagggtgatgtgtggatctgcatggagctcatggatacatcactagataaattctacaaacaagttattgataaaggccagacaattccagaggacatcttagggaaaatagcagtttctattgtaaaagcattagaacatttacatagtaagctgtctgtcattcacagagacgtcaagccttctaatgtactcatcaatgctctcggtcaagtgaagatgtgcgattttggaatcagtggctacttggtggactctgttgctaaaacaattgatgcaggttgcaaaccatacatggcccctgaaagaataaacccagagctcaaccagaagggatacagtgtgaagtctgacatttggagtctgggcatcacgatgattgagttggccatccttcgatttccctatgattcatggggaactccatttcagcagctcaaacaggtggtagaggagccatcgccacaactcccagcagacaagttctctgcagagtttgttgactttacctcacagtgcttaaagaagaattccaaagaacggcctacatacccagagctaatgcaacatccatttttcaccctacatgaatccaaaggaacagatgtggcatcttttgtaaaactgattcttggagactaa
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,339 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase 6, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase 6
NCBI Official Symbol
MAP2K6
NCBI Official Synonym Symbols
MEK6; MKK6; MAPKK6; PRKMK6; SAPKK3; SAPKK-3
NCBI Protein Information
dual specificity mitogen-activated protein kinase kinase 6
UniProt Protein Name
Dual specificity mitogen-activated protein kinase kinase 6
UniProt Gene Name
MAP2K6
UniProt Synonym Gene Names
MEK6; MKK6; PRKMK6; SKK3; MAP kinase kinase 6; MAPKK 6; MEK 6; SAPK kinase 3; SAPKK-3; SAPKK3
UniProt Entry Name
MP2K6_HUMAN

NCBI Description

This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]

Uniprot Description

MKK6: a dual-specificity protein kinase of the STE7 family. Activates p38 MAP kinase by phosphorylating a Thr and a Tyr residue in the activation loop. Is activated by cytokines and environmental stress in vivo. Three alternatively spliced isoforms have been reported.

Protein type: EC 2.7.12.2; Protein kinase, dual-specificity (non-receptor); Kinase, protein; Protein kinase, STE; STE group; STE7 family

Chromosomal Location of Human Ortholog: 17q24.3

Cellular Component: cytoplasm; cytosol; nucleoplasm

Molecular Function: MAP kinase kinase activity; protein binding; protein kinase binding; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; cell cycle arrest; DNA damage induced protein phosphorylation; signal transduction

Research Articles on MAP2K6

Similar Products

Product Notes

The MAP2K6 map2k6 (Catalog #AAA1269314) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcagt cgaaaggcaa gaagcgaaac cctggcctta aaattccaaa agaagcattt gaacaacctc agaccagttc cacaccacct cgagatttag actccaaggc ttgcatttct attggaaatc agaactttga ggtgaaggca gatgacctgg agcctataat ggaactggga cgaggtgcgt acggggtggt ggagaagatg cggcacgtgc ccagcgggca gatcatggca gtgaagcgga tccgagccac agtaaatagc caggaacaga aacggctact gatggatttg gatatttcca tgaggacggt ggactgtcca ttcactgtca ccttttatgg cgcactgttt cgggagggtg atgtgtggat ctgcatggag ctcatggata catcactaga taaattctac aaacaagtta ttgataaagg ccagacaatt ccagaggaca tcttagggaa aatagcagtt tctattgtaa aagcattaga acatttacat agtaagctgt ctgtcattca cagagacgtc aagccttcta atgtactcat caatgctctc ggtcaagtga agatgtgcga ttttggaatc agtggctact tggtggactc tgttgctaaa acaattgatg caggttgcaa accatacatg gcccctgaaa gaataaaccc agagctcaac cagaagggat acagtgtgaa gtctgacatt tggagtctgg gcatcacgat gattgagttg gccatccttc gatttcccta tgattcatgg ggaactccat ttcagcagct caaacaggtg gtagaggagc catcgccaca actcccagca gacaagttct ctgcagagtt tgttgacttt acctcacagt gcttaaagaa gaattccaaa gaacggccta catacccaga gctaatgcaa catccatttt tcaccctaca tgaatccaaa ggaacagatg tggcatcttt tgtaaaactg attcttggag actaa. It is sometimes possible for the material contained within the vial of "MAP2K6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.