Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTBS cdna clone

CTBS cDNA Clone

Gene Names
CTBS; CTB
Synonyms
CTBS; CTBS cDNA Clone; CTBS cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccggccgcagcttcgacgctggcgtctcgtctctagcccgccgagcggcgtcccgggtctagcgctgctggcgctgctggcgctgcggctcgcggccgggaccgactgcccatgcccggagcctgagctttgccgcccgattcgccaccatccagatttcgaggtctttgtgtttgatgttggacagaaaacttggaaatcttatgattggtcacagattacaactgtggcaacatttggaaaatatgactcagaacttatgtgctacgctcattcaaaaggagccagagtagtacttaaaggtaacctttga
Sequence Length
318
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,760 Da
NCBI Official Full Name
Homo sapiens chitobiase, di-N-acetyl-, mRNA
NCBI Official Synonym Full Names
chitobiase
NCBI Official Symbol
CTBS
NCBI Official Synonym Symbols
CTB
NCBI Protein Information
di-N-acetylchitobiase
UniProt Protein Name
Di-N-acetylchitobiase
Protein Family
UniProt Gene Name
CTBS
UniProt Synonym Gene Names
CTB
UniProt Entry Name
DIAC_HUMAN

NCBI Description

Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]).[supplied by OMIM, Nov 2010]

Uniprot Description

CTBS: Involved in the degradation of asparagine-linked glycoproteins. Hydrolyze of N-acetyl-beta-D-glucosamine (1-4)N- acetylglucosamine chitobiose core from the reducing end of the bond, it requires prior cleavage by glycosylasparaginase. Belongs to the glycosyl hydrolase 18 family.

Protein type: Hydrolase; EC 3.2.1.-

Chromosomal Location of Human Ortholog: 1p22

Cellular Component: extracellular space

Molecular Function: chitin binding; chitinase activity

Biological Process: chitin catabolic process

Research Articles on CTBS

Similar Products

Product Notes

The CTBS ctbs (Catalog #AAA1269306) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccggc cgcagcttcg acgctggcgt ctcgtctcta gcccgccgag cggcgtcccg ggtctagcgc tgctggcgct gctggcgctg cggctcgcgg ccgggaccga ctgcccatgc ccggagcctg agctttgccg cccgattcgc caccatccag atttcgaggt ctttgtgttt gatgttggac agaaaacttg gaaatcttat gattggtcac agattacaac tgtggcaaca tttggaaaat atgactcaga acttatgtgc tacgctcatt caaaaggagc cagagtagta cttaaaggta acctttga. It is sometimes possible for the material contained within the vial of "CTBS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.